Difference between revisions of "Part:BBa K2918012"

Latest revision as of 17:52, 6 December 2019

RiboJ

Sequence and Features

The part has been confirmed by sequencing and has no mutations.

Usage and Biology

Many promoter parts contain sequences downstream of the Transcription Start Site (such as operators or assembly fusion sites) resulting in extra unintended sequences in the transcript. These additional sequences are shown to significantly affect gene expression levels, disrupting the modularity and predictability of synthetic parts (Lou et al., 2012). Therefore, to insulate the translation rates of the part from the use of different promoters, ribozymes can be used for their self cleavage properties and remove these sequences upstream of mRNA. By the inclusion of ribozymes in 5’ UTR parts, outputs of genetic circuits will be insulated from genetic context, but the presence of multiple copies of the same ribozyme in different genes may result in homologous recombination (Lou et al., 2012). With that in mind, we, from TU Delft 2019, have designed Type IIS parts of both ribozymes and RBS for modular assembly in any combination desired.

Unfortunately, junction sequences such as Type IIS overhangs between ribozyme and RBS can also influence translation rates. To achieve scarless modular cloning of ribozymes and RBS, the strategy illustrated below can be adopted.

Lou et al. have screened and identified a series of ribozymes for insulating genetic circuits. All of these ribozymes contain conserved 3’ ends (ACCTCTACAAATAATTTTGTTTAA) and the 4 highlighted nucleotides can be used as a fusion site identified as compatible to Type IIS cloning. In the RBS sequence, AA should be added upstream in order to complement the incomplete ribozyme sequence when assembled.

Strain Construction

The DNA sequence of the part was synthesized by IDT with flanking BsaI sites and 'TACT' and 'GTTT' as 5' and 3' overhangs respectively. The ribozyme was then cloned along with an altered RBS in a level 0 MoClo backbone pICH41246 and the sequence was confirmed by sequencing. Click here for the detailed protocol.

Modular Cloning

Modular Cloning (MoClo) is a system which allows for efficient one pot assembly of multiple DNA fragments. The MoClo system consists of Type IIS restriction enzymes that cleave DNA 4 to 8 base pairs away from the recognition sites. Cleavage outside of the recognition site allows for customization of the overhangs generated. The MoClo system is hierarchical. First, basic parts (promoters, UTRs, CDS and terminators) are assembled in level 0 plasmids in the kit. In a single reaction, the individual parts can be assembled into vectors containing transcriptional units (level 1). Furthermore, MoClo allows for directional assembly of multiple transcriptional units. Successful assembly of constructs using MoClo can be confirmed by visual readouts (blue/white or red/white screening). For the protocol, you can find it here.

Note: The basic parts sequences of the Sci-Phi 29 collection in the registry contain only the part sequence and therefore contain no overhangs or restriction sites. For synthesizing MoClo compatible parts, refer to table 2.

Table 1: Overview of different level in MoClo

For synthesizing basic parts, the part of interest should be flanked by a BpiI site and its specific type overhang. These parts can then be cloned into the respective level 0 MoClo parts. For level 1, where individual transcriptional units are cloned, the overhangs come from the backbone you choose. The restriction sites for level 1 are BsaI. However, any type IIS restriction enzyme could be used.

Table 2: Type specific overhangs and backbones for MoClo. Green indicates the restriction enzyme recognition site. Blue indicates the specific overhangs for the basic parts

References

• Lou, C., Stanton, B., Chen, Y.-J., Munsky, B., & Voigt, C. A. (2012). Ribozyme-based insulator parts buffer synthetic circuits from genetic context. Nature Biotechnology, 30(11), 1137–1142.