Difference between revisions of "Part:BBa K3042001"
(5 intermediate revisions by the same user not shown) | |||
Line 3: | Line 3: | ||
<partinfo>BBa_K3042001 short</partinfo> | <partinfo>BBa_K3042001 short</partinfo> | ||
− | The RNA complex sequence from dinoflagellate Karenia brevis (GenBank accession # FJ434727) containing SL RNA, SRP RNA, several tRNAs, and U6. | + | The RNA complex sequence from dinoflagellate Karenia brevis (GenBank accession # FJ434727) containing SL RNA, SRP RNA, several tRNAs, and U6. SymLHC3_5R primer and SymLHC5_3F primer were designed to contain an overhang in the “termination” region or the “promoter” region in order to link the two PCR products. The two products were used as a template for the second PCR, which resulted in a single product. The product was verified and digested with SpeI and EcoRI due to the SymkaLHC5FN1 and SymkaLHC3R1 primers used for the promoter and termination regions containing a SpeI site and an EcoRI site added to their 5’ ends for easy incorporation into pMD-Dino, which contains the RNA complex sequence. Furthermore, the pMD-Dino was PCR amplified with a DinoSL and KbrSRP-U6R1 primer set and incorporated to create a functional dinoflagellate backbone vector, DinoIII (Sprecher, 2019). |
Line 10: | Line 10: | ||
<!-- --> | <!-- --> | ||
− | <span class='h3bb'>Sequence and Features</span> | + | <span class='h3bb'><b>Sequence and Features</b></span> |
+ | <p>Primer Sequences:</p> | ||
+ | <p>DinoSL NCCGTAGCCATTTTGGCTCAAG</p> | ||
+ | <p>KbrSRP-U6R1 CAGAGATCAAGACATGCTTCAGGAC</p> | ||
<partinfo>BBa_K3042001 SequenceAndFeatures</partinfo> | <partinfo>BBa_K3042001 SequenceAndFeatures</partinfo> | ||
Latest revision as of 02:29, 22 October 2019
RNA complex sequence from dinoflagellate Karenia brevis
The RNA complex sequence from dinoflagellate Karenia brevis (GenBank accession # FJ434727) containing SL RNA, SRP RNA, several tRNAs, and U6. SymLHC3_5R primer and SymLHC5_3F primer were designed to contain an overhang in the “termination” region or the “promoter” region in order to link the two PCR products. The two products were used as a template for the second PCR, which resulted in a single product. The product was verified and digested with SpeI and EcoRI due to the SymkaLHC5FN1 and SymkaLHC3R1 primers used for the promoter and termination regions containing a SpeI site and an EcoRI site added to their 5’ ends for easy incorporation into pMD-Dino, which contains the RNA complex sequence. Furthermore, the pMD-Dino was PCR amplified with a DinoSL and KbrSRP-U6R1 primer set and incorporated to create a functional dinoflagellate backbone vector, DinoIII (Sprecher, 2019).
Sequence and Features
Primer Sequences:
DinoSL NCCGTAGCCATTTTGGCTCAAG
KbrSRP-U6R1 CAGAGATCAAGACATGCTTCAGGAC
- 10INCOMPATIBLE WITH RFC[10]Illegal SpeI site found at 636
Illegal PstI site found at 350
Illegal PstI site found at 512 - 12INCOMPATIBLE WITH RFC[12]Illegal SpeI site found at 636
Illegal PstI site found at 350
Illegal PstI site found at 512 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal SpeI site found at 636
Illegal PstI site found at 350
Illegal PstI site found at 512 - 25INCOMPATIBLE WITH RFC[25]Illegal SpeI site found at 636
Illegal PstI site found at 350
Illegal PstI site found at 512 - 1000COMPATIBLE WITH RFC[1000]