Difference between revisions of "Part:BBa J23103:Experience"

(→‎Description)
 
(22 intermediate revisions by the same user not shown)
Line 54: Line 54:
 
|[[Image:MRFP data graph.png|450px|thumb|center|mRFP fluorescence intensity under different promoters]]||
 
|[[Image:MRFP data graph.png|450px|thumb|center|mRFP fluorescence intensity under different promoters]]||
 
|}
 
|}
−
 
+
|}
 
<!-- DON'T DELETE --><partinfo>BBa_J23103 EndReviews</partinfo>
 
<!-- DON'T DELETE --><partinfo>BBa_J23103 EndReviews</partinfo>
−
 
−
 
−
<br><br><br><br><br>
 
  
  
Line 69: Line 66:
 
|width='60%' valign='top'|
 
|width='60%' valign='top'|
  
−
====UT Austin iGEM 2019: Characterization of metabolic burden of the Anderson Series====
+
<h3>UT Austin iGEM 2019: Characterization of metabolic burden of the Anderson Series</h3>
  
 +
<h4>Description</h4>
 +
The 2019 UT Austin iGEM team transformed the Anderson Series promoters into our 'burden monitor' DH10B strain of E. coli, which contains a constitutive GFP cassette in the genome of the cell. GFP expression fluctuates depending on the number of ribosomes available. Using this strain, we characterized the relative burden (percent reduction in growth rate) of each Anderson Series part. Our results showed a range of growth rate reductions for each of these parts due to ribosomal reallocation from the genome of the host cell, towards the expression of RFP. Anderson Series parts with strong promoters are depicted with darker red colors and Anderson Series parts with weak promoters are depicted with lighter pink colors to show relative RFP expression.
 +
We saw a positive correlation between relative promoter strength and metabolic burden; parts with stronger promoters expressed less GFP and had a lower growth rate than parts with weaker promoters. The regression line for the graph below was constructed by measuring the burden of 5 parts that were created by the 2019 UT Austin iGEM team that each contained an Anderson Series promoter (<partinfo>J23104</partinfo> or <partinfo>J23110</partinfo>), an RBS of varying strength, and a BFP reporter. For more information on characterization of these parts through the burden monitor, visit our team’s wiki page: [https://https://2019.igem.org/Team:Austin_UTexas]
  
−
===Description===
+
<html>
−
The 2019 UT Austin iGEM team transformed the Anderson Series promoters into our 'burden monitor' DH10B strain of E. coli which contains a constitutive GFP cassette in the genome of the cell. This GFP expression rate fluctuates depending on the number of ribosomes available for the host cell to sustain itself. Using this strain, the relative burden (percent reduction in growth rate) of each Anderson Series part was determined. Our results showed a range of growth rate reductions due to ribosomal reallocation from the genome of the host cell, towards the genetic circuit. Anderson Series parts with strong promoters are depicted with darker red colors and Anderson Series parts with weak promoters are depicted with lighter pink colors.
+
<figure>
−
We saw a positive correlation between relative promoter strength and metabolic burden; parts with stronger promoters expressed less GFP and had a lower growth rate than parts with weaker promoters. The regression line for the graph below was constructed by measuring the burden of 5 parts that were created by the 2019 UT Austin iGEM team that each contained Anderson Series promoters (<partinfo>J23104</partinfo> or <partinfo>J23110</partinfo>), an RBS of varying strength, and a BFP reporter. For more information on characterization of these parts through burden monitoring and evolutionary stability experiments, visit our team’s wiki page: [https://https://2019.igem.org/Team:Austin_UTexas]
+
<div class = "left">
 +
<img src = "https://static.igem.org/mediawiki/parts/a/a0/AndersonCharacterization.jpg" style = "width:550px;height:500px">
 +
</div>
 +
<figcaption><b>Fig.1:</b>Growth vs GFP Expression graph showing the relative burden positions of the Anderson Series promoters. The parts with strong promoters are depicted in dark red and are clustered near the bottom of the graph because they have lower growth rates and express lower levels of GFP as a result of high cellular burden. The parts with weaker promoter are depicted in light pink ad are clustered near the top of the graph because they have higher growth rates and express higher levels of GFP as a result of low cellular burden.</figcaption>
 +
</figure>
 +
</html>
 +
<br><br>
 +
<html>
 +
<figure>
 +
<div class = "left">
 +
<img src = "https://static.igem.org/mediawiki/parts/8/80/T--Austin_Utexas--andersontable.png" style = "width:545px;height:375px">
 +
</div>
 +
<figcaption><b>Table.1:</b> Burden measurements for the Anderson Series promoters measured as percent reduction in growth rate ± 95% confidence interval. </figcaption>
 +
</figure>
 +
</html>
  
−
[[Image: AndersonCharacterization.jpg|450px]]
+
<h4>Importance of Characterizing Burden</h4>
 +
<p> Although often we cannot avoid using a specific burdensome part, knowing in advance that it is burdensome, and that it has a high chance of mutating into a non-functional genetic device, can help with troubleshooting and coming up with alternatives. In the specific case of fluorescent protein-expressing devices, Fluorescence-activated cell sorting (FACS) can be used to filter out individual cells that meet a certain fluorescence threshold. This way, the cells expressing lower levels of the fluorescent protein are weeded out of the population.</p>

Latest revision as of 20:07, 21 October 2019

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_J23103

Use of this promoter by team Glasgow 2014

We found this promoter is actually identical in sequence to BBa_J23112

BBa_J23116, BBa_J23106, BBa_J23103, and BBa_J23112 were used to express motA and motB together in our composite biobricks:
BBa_ K1463773, BBa_ K1463772, BBa_ K1463770, and BBa_ K1463771 respectively.
These composite biobricks were used to complement the swimming defect of a motA E. coli mutant.
We found that swimming was restored in the following order:
BBa_J23116 > BBa_J23106 > BBa_J23103 = BBa_J23112.
Examination of the sequences of BBa_J23103 and BBa_J23112 showed that they are identical, despite showing different levels of RFP expression in their initial characterisation!

>BBa_J23103 Part-only sequence (35 bp) ctgatagctagctcagtcctagggattatgctagc

>BBa_J23112 Part-only sequence (35 bp) ctgatagctagctcagtcctagggattatgctagc

Evaluation of Anderson promoter J23103 in B. subtilis by iGEM-Team LMU-Munich 2012

This Anderson promoter was evaluated without fused RFP with the lux operon as a reporter in B. subtilis. See the new BioBrick BBa_K823007 without RFP and have a look at the [http://2012.igem.org/Team:LMU-Munich/Data/Anderson Data] from the evaluation in B. subtilis.

User Reviews

UNIQdfbba33f8fb83b03-partinfo-00000000-QINU

•••••

iGEM HKU 2011

To start characterizing the promoters, we have performed the red florescence intensity measurements for our selected plasmid in the E.Coli MG1655 strain. The data collected is shown below. It is found that promoter J23106 can lead to a higher expression since the fluorescence intensity per OD600 is the highest, while J23103, J23109, J23116 have relative low expression and fluorescence. As our selected promoters have different strength, thus our team is able to use them to fine tune the protein expression.

mRFP fluorescence intensity under different promoters

UNIQdfbba33f8fb83b03-partinfo-00000002-QINU


•••••

University of Texas at Austin iGEM 2019

UT Austin iGEM 2019: Characterization of metabolic burden of the Anderson Series

Description

The 2019 UT Austin iGEM team transformed the Anderson Series promoters into our 'burden monitor' DH10B strain of E. coli, which contains a constitutive GFP cassette in the genome of the cell. GFP expression fluctuates depending on the number of ribosomes available. Using this strain, we characterized the relative burden (percent reduction in growth rate) of each Anderson Series part. Our results showed a range of growth rate reductions for each of these parts due to ribosomal reallocation from the genome of the host cell, towards the expression of RFP. Anderson Series parts with strong promoters are depicted with darker red colors and Anderson Series parts with weak promoters are depicted with lighter pink colors to show relative RFP expression. We saw a positive correlation between relative promoter strength and metabolic burden; parts with stronger promoters expressed less GFP and had a lower growth rate than parts with weaker promoters. The regression line for the graph below was constructed by measuring the burden of 5 parts that were created by the 2019 UT Austin iGEM team that each contained an Anderson Series promoter (BBa_J23104 or BBa_J23110), an RBS of varying strength, and a BFP reporter. For more information on characterization of these parts through the burden monitor, visit our team’s wiki page: [1]

Fig.1:Growth vs GFP Expression graph showing the relative burden positions of the Anderson Series promoters. The parts with strong promoters are depicted in dark red and are clustered near the bottom of the graph because they have lower growth rates and express lower levels of GFP as a result of high cellular burden. The parts with weaker promoter are depicted in light pink ad are clustered near the top of the graph because they have higher growth rates and express higher levels of GFP as a result of low cellular burden.


Table.1: Burden measurements for the Anderson Series promoters measured as percent reduction in growth rate ± 95% confidence interval.

Importance of Characterizing Burden

Although often we cannot avoid using a specific burdensome part, knowing in advance that it is burdensome, and that it has a high chance of mutating into a non-functional genetic device, can help with troubleshooting and coming up with alternatives. In the specific case of fluorescent protein-expressing devices, Fluorescence-activated cell sorting (FACS) can be used to filter out individual cells that meet a certain fluorescence threshold. This way, the cells expressing lower levels of the fluorescent protein are weeded out of the population.