Difference between revisions of "Part:BBa K3075004"
Line 5: Line 5:
 
=== Introduction ===
 
=== Introduction ===
  
−
DBAT-Snooptag-His consists of the enzyme 10-deacetylbaccatin III 10-O-acetyltransferase (DBAT) fused to a short C-terminal polypeptide tag (Snooptag) and a Hexahistidine Tag (6xHis-tag), separated by interconnecting GSG linkage sequences. The sequence of DBAT which was used, originated from ''Taxus cuspidata'' (Japanese yew), with a double mutation of G38R/F301V (2). The SnoopTag is a small polypeptide tag that spontaneously forms an isopeptide bond between reactive amino acid side chains to its corresponding SnoopCatcher (Brune, 2017). This system opens up a variety of applications, utilising the catcher-tag conjugation system for bioconjugation and synthetic assembly of the DBAT enzyme to SnoopCatcher containing proteins.  
+
mCerulean3 CFP (Cyan Fluorescent Protein) is an optimized FRET donor molecule that was rationally designed by Piston and co-workers to eliminate the excited-state heterogeneity of ECFP. In ECFP, a single-exponential fit to the fluorescence lifetime is not feasible due to multiple components, whereas Cerulean exhibits essentially homogeneous excited-state decay kinetics, rendering this protein useful for lifetime imaging.Live cell imaging experiments have demonstrated that Cerulean CFP undergoes highly efficient FRET to yellow acceptor molecules (25, 26). Additionally, Cerulean exhibits more than twice the brightness of ECFP and CyPet, emitting light at fluorescence intensities similar to Citrine (20). His-mCerulean3-SnoopT is an improvement of part [https://parts.igem.org/Part:BBa_J18930 BBa_J18930], submitted by 2019 UNSW iGEM.
  
−
[[File:Part-BBa_K3075001-Introduction.png]]
+
The Hexahistidine tag (his-tag) is a common additive due to its high affinity for metal ions used in the purification technique of immobilized metal affinity chromatography (IMAC). Ni2+ ions were used for his-tag purification due to its high yield.  
  
−
The Hexahistidine tag is a common additive due to its high affinity for metal ions used in the purification technique of immobilized metal affinity chromatography (IMAC). Ni2+ ions were used for his-tag purification due to its high yield.
+
=== Primer-Directed Gene modification by PCR ===
 +
=== Primers ===
  
−
=== Usage and Biology ===
+
Primers were designed for the addition of an N-terminal hexahistidine tag and Gibson overhangs to the 5’- and 3’- terminus of the CFP sequence. The primers used for modification are below:
  
−
This protein naturally participates in the synthesis of baccatin III, where it catalyses the final acetylation of 10-deacetylbaccatin III. Baccatin III synthesis is a subpathway of paclitaxel biosynthesis, which is itself part of Alkaloid biosynthesis. The mutant however, has been designed to catalyse the acetylation of 10-deacetyltaxol (DT) with a catalytic efficiency approximately six times higher than that of the wild-type. (2) The recombinant mutant enzyme has a length of 440 amino acid residues, a molecular weight of 49,052 Da and an optimum pH of 7.5. (3)
+
:*CFP Forward: 5’-ACTTTAAGAAGGAGATATACCATGCAC
 +
:*CFP Reverse: 5’-TCGGGCTTTGTTAGCAGCCGTCATTTGTTTACTTTAATGAACTCGATGTCGCCCAACTTACCTGATCCTTTATACAGTT
  
−
=== Characterisation ===
 
  
−
The gBlock was assembled into the pET19b expression vector at the multiple cloning site via gibson assembly with a 3-fold excess of insert to vector <link to protocols>. Gibson products were transformed into high efficiency T7 Express E. coli (NEB) by heat shocking at 42°C and cells were plated on ampicillin supplemented agar plates for selection. Transformants were screened for recombinant plasmids by colony PCR (figure ??). Colonies resulting in amplicons with an observed molecular weight of approximately 1.5 kb were grown overnight in a 5 mL culture and plasmid DNA was extracted by miniprep and submitted for sequence confirmation via Sanger sequencing (Figure ??).  
+
=== Polymerase Chain Reaction (PCR) ===
 +
Polymerase Chain Reaction (PCR) was used to modify and linearise the His-mCerulean3-SnoopTag gene. PCR was performed using the following conditions:
  
−
Image
+
'''Table 1:''' PCR Thermocycling conditions to amplify the His-mCerulean3-SnoopT gene fragment
  
−
Figure 2. Recombinant DBAT-SnoopT-His gene amplified by colony PCR at annealing temperature 67.6°C and extension time 43 seconds, else as per protocol. 10 uL of PCR product was run on a 1% agarose gel at 100 V for 1 hour using 5 uL of 2-log DNA ladder (NEB) as a standard (Lane 1). Single band at ~1.5kb.
+
[[File:mcer_table.png]]
  
−
Figure 3. DBAT-SnoopT-His sequence chromatogram.
+
::Gradient annealing temperature can be used to empirically determine the optimal annealing temperature.  
 +
:Detailed protocols here <https://2019.igem.org/Team:UNSW_Australia/Protocols>
  
−
'''Protein expression assay'''
+
PCR products were run on a 1% agarose gel in 1X TAE buffer for 1 hour at 100V and imaged in a GelDoc under the transilluminator setting (Figure omitted). Samples with amplicons of an approximate size of 800 bp was purified for further ligation. Circular template plasmids were cleaved by DpnI digestion and purified using a PCR clean up kit (QIAGEN). Purified amplicons were then ligated into the pET-19b backbone via Gibson Assembly.
  
−
Cells containing a plasmid with the DBAT insert were grown up and a sample of this was used to perform a protein expression assay. Bug buster was used to separate soluble and insoluble proteins. LXYL was not successfully cloned thus could not be expressed.
+
=== Assembly of mCerulean3-SnoopT into pET-19b ===
  
−
Image
+
Modified mCerulean3-SnoopTag was assembled into the pET-19b backbone by Gibson Assembly. A 3X molar excess of linear mCerulean3-SnoopT was incubated with linear pET-19b backbone and 2X Gibson Master Mix (NEB) at 50°C for 1 hour. The gibson mixture was transformed into T7 Express E. coli by heat shocking at 42°C for 10 seconds. Transformants were plated onto Luria Broth (LB) Agar plates supplemented with Ampicillin and incubated overnight at 37°C. Transformant colonies were screened using colony PCR under the same conditions as in Table 1. The Initial Denaturation step at 98°C was extended to 3 minutes for cell lysis.
  
−
Figure ?. Protein expression assay using bug buster to determine expression of 10-deacetylbaccatin III 10-O-acetyltransferase (DBAT) as soluble and insoluble form.
+
Primers used for Colony PCR:
 +
:*T7 Forward : 5’-TAATACGACTCACTATAGGG
 +
:*T7 Reverse : 5’-GCTAGTTATTGCTCAGCGG
  
−
'''Purification'''
+
PCR products were run on a 1% agarose gel in 1X TAE buffer for 1 hour at 100V (Figure 2). Colonies obtaining amplicons with an observed molecular weight of approximately 800 bp were grown up overnight in a 5mL culture of Luria Broth supplemented with ampicillin. Plasmid DNA was extracted by miniprep and purified mCerulean3 constructs were submitted for sequence confirmation by Sanger sequencing.
  
−
Following the confirmation of protein expression indicated by bug buster gels, attempts were made to purify DBAT.
 
  
−
Image
+
=== Characterisation ===
−
 
+
−
Figure ?. SDS-PAGE of AKTA purification fractions of DBAT His-tagged protein
+
−
 
+
−
'''Liquid Chromatography with tandem mass spectrometry'''
+
−
 
+
−
Soluble protein bands (fractions 4-7) as well as a total protein lysate band at the same predicted molecular weight as DBAR were excised from the gel of purified fractions in Figure? And sent for analysis by Liquid Chromatography with tandem mass spectrometry (LCMSMS). This was performed to determine the identity of the protein bands by mapping peptides detected by LCMSMS onto the sequence of DBAT obtained from sequencing data of the cloned insert.
+
−
 
+
−
Image
+
−
 
+
−
Figure ?.  Liquid Chromatography with tandem mass spectrometry analysis of suspected DBAT protein bands excises form Figure ? protein gel. A: Total protein lysate sample. B: soluble protein sample taken from fractions 4-7.
+

Revision as of 20:05, 21 October 2019

His-mCerulean3-SnoopT


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 43
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Introduction

mCerulean3 CFP (Cyan Fluorescent Protein) is an optimized FRET donor molecule that was rationally designed by Piston and co-workers to eliminate the excited-state heterogeneity of ECFP. In ECFP, a single-exponential fit to the fluorescence lifetime is not feasible due to multiple components, whereas Cerulean exhibits essentially homogeneous excited-state decay kinetics, rendering this protein useful for lifetime imaging.Live cell imaging experiments have demonstrated that Cerulean CFP undergoes highly efficient FRET to yellow acceptor molecules (25, 26). Additionally, Cerulean exhibits more than twice the brightness of ECFP and CyPet, emitting light at fluorescence intensities similar to Citrine (20). His-mCerulean3-SnoopT is an improvement of part BBa_J18930, submitted by 2019 UNSW iGEM.

The Hexahistidine tag (his-tag) is a common additive due to its high affinity for metal ions used in the purification technique of immobilized metal affinity chromatography (IMAC). Ni2+ ions were used for his-tag purification due to its high yield.

Primer-Directed Gene modification by PCR

Primers

Primers were designed for the addition of an N-terminal hexahistidine tag and Gibson overhangs to the 5’- and 3’- terminus of the CFP sequence. The primers used for modification are below:

  • CFP Forward: 5’-ACTTTAAGAAGGAGATATACCATGCAC
  • CFP Reverse: 5’-TCGGGCTTTGTTAGCAGCCGTCATTTGTTTACTTTAATGAACTCGATGTCGCCCAACTTACCTGATCCTTTATACAGTT


Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) was used to modify and linearise the His-mCerulean3-SnoopTag gene. PCR was performed using the following conditions:

Table 1: PCR Thermocycling conditions to amplify the His-mCerulean3-SnoopT gene fragment

Mcer table.png

Gradient annealing temperature can be used to empirically determine the optimal annealing temperature.
Detailed protocols here <https://2019.igem.org/Team:UNSW_Australia/Protocols>

PCR products were run on a 1% agarose gel in 1X TAE buffer for 1 hour at 100V and imaged in a GelDoc under the transilluminator setting (Figure omitted). Samples with amplicons of an approximate size of 800 bp was purified for further ligation. Circular template plasmids were cleaved by DpnI digestion and purified using a PCR clean up kit (QIAGEN). Purified amplicons were then ligated into the pET-19b backbone via Gibson Assembly.

Assembly of mCerulean3-SnoopT into pET-19b

Modified mCerulean3-SnoopTag was assembled into the pET-19b backbone by Gibson Assembly. A 3X molar excess of linear mCerulean3-SnoopT was incubated with linear pET-19b backbone and 2X Gibson Master Mix (NEB) at 50°C for 1 hour. The gibson mixture was transformed into T7 Express E. coli by heat shocking at 42°C for 10 seconds. Transformants were plated onto Luria Broth (LB) Agar plates supplemented with Ampicillin and incubated overnight at 37°C. Transformant colonies were screened using colony PCR under the same conditions as in Table 1. The Initial Denaturation step at 98°C was extended to 3 minutes for cell lysis.

Primers used for Colony PCR:

  • T7 Forward : 5’-TAATACGACTCACTATAGGG
  • T7 Reverse : 5’-GCTAGTTATTGCTCAGCGG

PCR products were run on a 1% agarose gel in 1X TAE buffer for 1 hour at 100V (Figure 2). Colonies obtaining amplicons with an observed molecular weight of approximately 800 bp were grown up overnight in a 5mL culture of Luria Broth supplemented with ampicillin. Plasmid DNA was extracted by miniprep and purified mCerulean3 constructs were submitted for sequence confirmation by Sanger sequencing.


Characterisation