Difference between revisions of "Part:BBa K523013"
Line 54: | Line 54: | ||
The results of the sequencing were 99% similar to the given sequence, and we believe that the lack of 1% similarity may be related to the unreliable sequencing results at the initial position (within 50 bp). Sequencing shows that the ratio of guanine and cytosine is about 55%, and usually 45%-55% of the fragments are better amplified and suitable for PCR amplification. | The results of the sequencing were 99% similar to the given sequence, and we believe that the lack of 1% similarity may be related to the unreliable sequencing results at the initial position (within 50 bp). Sequencing shows that the ratio of guanine and cytosine is about 55%, and usually 45%-55% of the fragments are better amplified and suitable for PCR amplification. | ||
[[File:BIT-China bronze 1.png|thumb|center|400px|<b>Fig.Sequencing results of K523013.</b>]]<br><br> | [[File:BIT-China bronze 1.png|thumb|center|400px|<b>Fig.Sequencing results of K523013.</b>]]<br><br> | ||
− | + | Primer F:ttaatacgactcactatagggagaggagg | |
− | + | Primer R:ggctcaccttcgggtgggcctttctgcgtttata | |
<!-- Uncomment this to enable Functional Parameter display | <!-- Uncomment this to enable Functional Parameter display | ||
===Functional Parameters=== | ===Functional Parameters=== | ||
<partinfo>BBa_K523013 parameters</partinfo> | <partinfo>BBa_K523013 parameters</partinfo> | ||
<!-- --> | <!-- --> |
Revision as of 18:45, 21 October 2019
Plac + INP-EYFP
Fusion of Ice Nucleation Protein (INP) and Enhanced Yellow Fluorescent Protein (EYFP) under the control of the Lac promoter.
Constructed using the BioSandwich protocol of Edinburgh 2011.
Usage and Biology
Cells expressing this construct are shown on the right. The cells fluoresce yellow under blue light. The INP should carry the EYFP to the outer membrane of E. coli. Our imaging technology was not good enough to confirm this, so we attempted to prove it by other means...
Fractionation experiment
We (Edinburgh 2011) centrifuged cells expressing BBa_K523013 so that the membrane fraction became localised to the bottom of the tube, and compared the fluorescence pattern with a control where EYFP was not fused to INP.
![]() |
![]() | |
Control on left. INP-EYFP on right. | The same image passed through GIMP's auto white balance filter. |
These results appear to indicate that the EYFP was successfully transported to the outer membrane; this region is the main source of fluorescence in the INP-EYFP tube. By contrast, the control tube has much more EYFP present in the cytoplasm.
More Characterization
Take a look at the experience part where you can find further Characterisations done by the iGEM13_EPF_Lausanne Team.
Improvement by BJRS_China 2018
Our project used surface display system, and we choose this part to construct the INP-mediated surface display system for our interest protein. While testing the surface display efficiency of this part, we found that the fluorescence intensity was too weak both under the uv-light(adjusted to the same OD600)(Fig.2, middle) and under the super resolution microscope(Fig.3, middle).
To characterize the surface display efficiency of INP better, we added a strong promoter J23104 and RBS B0032 to the upstream of INP, and changed the YFP to sfGFP, to construct our parts BBa_K2833009(Fig.1).
![](/wiki/images/b/b5/T--BJRS_China--improvement009.png)
We also conducted the cell lysis experiment to observe the distribution of GFP(figure 4). We firstly adjusted the OD600 of all the interest overnight cultured bacteria to 1.0 and then lysed the cells using Ultrasonic Cell Disruptor. The results showed that after cell lysis followed by centrifuge, both the precipitation and supernatant shows relative strong fluorescence signal in intracellular expressing GFP bacteria(figure 4B, middle), while the signal was stronger in supernatant than in precipitation in BBa_K2833009 transformed bacteria(figure 4B, right).To further confirm this result, we removed the supernatant and observed that the signal in BBa_K2833009 transformed bacteria fragments was stronger than the GFP intracellular expressed ones(figure 4C). This suggests that the surface displayed GFP were anchored to the outer membrane and being precipitated with the cell fragment, while the intracellular expressed GFP were solved in the supernatant.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 1036
- 1000COMPATIBLE WITH RFC[1000]
Sequencing by BIT-China 2019
The results of the sequencing were 99% similar to the given sequence, and we believe that the lack of 1% similarity may be related to the unreliable sequencing results at the initial position (within 50 bp). Sequencing shows that the ratio of guanine and cytosine is about 55%, and usually 45%-55% of the fragments are better amplified and suitable for PCR amplification.
Primer F:ttaatacgactcactatagggagaggagg
Primer R:ggctcaccttcgggtgggcctttctgcgtttata