Difference between revisions of "Part:BBa K2942706:Design"
| Line 7: | Line 7: | ||
Riboswitches is an element comprising a ribozyme actuator and RNA aptamer sensor, which could bind to a series of small molecular metabolites and iron ions to regulates transcription, translation, splicing and the stability of RNA [1]. | Riboswitches is an element comprising a ribozyme actuator and RNA aptamer sensor, which could bind to a series of small molecular metabolites and iron ions to regulates transcription, translation, splicing and the stability of RNA [1]. | ||
In our project, we use a kind of riboswitch developed from the hammerhead ribozyme from the satellite RNA of tobacco ringspot virus (sTRSV) conjugated to a theophylline aptamer. It’s an OFF-type riboswitch, which inhibits ribozyme cleavage in the absence of theophylline, but addition of theophylline allows the ribozyme to form its active conformation and initiate cleavage, turning gene expression off. By adding theophylline or not, we can control the expression of the pro-drug gene attached to M1 virus, which greatly improves the safety of M1 virus and efficiency of gene expression. | In our project, we use a kind of riboswitch developed from the hammerhead ribozyme from the satellite RNA of tobacco ringspot virus (sTRSV) conjugated to a theophylline aptamer. It’s an OFF-type riboswitch, which inhibits ribozyme cleavage in the absence of theophylline, but addition of theophylline allows the ribozyme to form its active conformation and initiate cleavage, turning gene expression off. By adding theophylline or not, we can control the expression of the pro-drug gene attached to M1 virus, which greatly improves the safety of M1 virus and efficiency of gene expression. | ||
| + | However, in our experiment we gained the result which is opposite to our expectation. There are several reasons we have considered for this result. For the one hand, we are likely to infer that it is possibly a on-switch. On the other hand, we also consider that maybe the insert of riboswitch has an influence on the expression of its downstream sequence, or there are more segments required for the expression of its downstream sequence. However, one thing we can sure is that the riboswitch did have the control function, and there are still many questions waiting for further exploration. | ||
The CMV(BBa_I712004)+riboswitches(BBa_2942701)+eGFP(BBa_I914891) was linked into the vector pSB1A3 between the restriction sites EcoRI and PstI using the Multiple fragment homologous recombination, and the correct construction of this recombinant plasmid was confirmed by PCR identification(Fig.1), sequencing of the recombinant plasmid (Fig.2)and the image of transfection cells with or without theophylline observed under a fluorescence microscope which can reflect whether the riboswitch is effective (Fig.3). | The CMV(BBa_I712004)+riboswitches(BBa_2942701)+eGFP(BBa_I914891) was linked into the vector pSB1A3 between the restriction sites EcoRI and PstI using the Multiple fragment homologous recombination, and the correct construction of this recombinant plasmid was confirmed by PCR identification(Fig.1), sequencing of the recombinant plasmid (Fig.2)and the image of transfection cells with or without theophylline observed under a fluorescence microscope which can reflect whether the riboswitch is effective (Fig.3). | ||
| − | |||
Primers for homologous recombination: | Primers for homologous recombination: | ||
PSBA3-F AACTGCAGTCCGGCAAAAAAGGGCAAG | PSBA3-F AACTGCAGTCCGGCAAAAAAGGGCAAG | ||
| Line 27: | Line 27: | ||
R CTTGTACAGCTCGTCCATG | R CTTGTACAGCTCGTCCATG | ||
| − | + | ||
| − | [[file: | + | |
| + | [[file:lyt061.png|720px]] | ||
| + | |||
Fig.1 PCR result. We extracted plasmids from the bacteria solution which shows correct sequencing result, and 1%agarose gel electrophoresis was performed to validate the PCR production of the fusion segment that has inserted between the restriction sites EcoRI and PstI. The primers for PCR are as above. | Fig.1 PCR result. We extracted plasmids from the bacteria solution which shows correct sequencing result, and 1%agarose gel electrophoresis was performed to validate the PCR production of the fusion segment that has inserted between the restriction sites EcoRI and PstI. The primers for PCR are as above. | ||
| − | [[file: | + | |
| + | [[file:lyt062.png|720px]] | ||
Fig.2 Sequencing result of the recombinant plasmid. The primers for sequencing are as above. You can click here to download the sequence files. | Fig.2 Sequencing result of the recombinant plasmid. The primers for sequencing are as above. You can click here to download the sequence files. | ||
| + | |||
| + | |||
| + | |||
| + | [[file:lyt063.png|720px]] | ||
Fig.3 Transfection cells observed under a fluorescence microscope. 293T cells were seeded 7.5×105 per well in the 6 well plate, and transfection was performed following the protocol of Invitrogen Lipofectamine™ 3000 Transfection Reagent when cells grow to 70-80% of the wells. We added 4mM theophylline (solved in PBS) into the experimental group according to the article mentioned above while equivoluminal PBS to control group 4h after transfection. the Fluorescence was observed 24h after the transfection. | Fig.3 Transfection cells observed under a fluorescence microscope. 293T cells were seeded 7.5×105 per well in the 6 well plate, and transfection was performed following the protocol of Invitrogen Lipofectamine™ 3000 Transfection Reagent when cells grow to 70-80% of the wells. We added 4mM theophylline (solved in PBS) into the experimental group according to the article mentioned above while equivoluminal PBS to control group 4h after transfection. the Fluorescence was observed 24h after the transfection. | ||
Revision as of 17:29, 21 October 2019
CMV promoter+riboswitch+eGFP
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
CMV promoter+ Riboswitch + eGFP
Riboswitches is an element comprising a ribozyme actuator and RNA aptamer sensor, which could bind to a series of small molecular metabolites and iron ions to regulates transcription, translation, splicing and the stability of RNA [1]. In our project, we use a kind of riboswitch developed from the hammerhead ribozyme from the satellite RNA of tobacco ringspot virus (sTRSV) conjugated to a theophylline aptamer. It’s an OFF-type riboswitch, which inhibits ribozyme cleavage in the absence of theophylline, but addition of theophylline allows the ribozyme to form its active conformation and initiate cleavage, turning gene expression off. By adding theophylline or not, we can control the expression of the pro-drug gene attached to M1 virus, which greatly improves the safety of M1 virus and efficiency of gene expression. However, in our experiment we gained the result which is opposite to our expectation. There are several reasons we have considered for this result. For the one hand, we are likely to infer that it is possibly a on-switch. On the other hand, we also consider that maybe the insert of riboswitch has an influence on the expression of its downstream sequence, or there are more segments required for the expression of its downstream sequence. However, one thing we can sure is that the riboswitch did have the control function, and there are still many questions waiting for further exploration. The CMV(BBa_I712004)+riboswitches(BBa_2942701)+eGFP(BBa_I914891) was linked into the vector pSB1A3 between the restriction sites EcoRI and PstI using the Multiple fragment homologous recombination, and the correct construction of this recombinant plasmid was confirmed by PCR identification(Fig.1), sequencing of the recombinant plasmid (Fig.2)and the image of transfection cells with or without theophylline observed under a fluorescence microscope which can reflect whether the riboswitch is effective (Fig.3). Primers for homologous recombination: PSBA3-F AACTGCAGTCCGGCAAAAAAGGGCAAG PSBA3-R CGAATTCCAGAAATCATCCTTAGCGAAAGCTAAGG CMV-F TAAGGATGATTTCTGGAATTCGTGATGCGGTTTTGGCAGT CMVR-RIBO-R CGGTGACAGCTTTGTTTGTTTAGCTCTGCTTATATAAACCTCC RIBOF AAACAAACAAAGCTGTCACCGGATGTGC RIBO-GFP-R CTCCTCGCCCTTGCTCACCATGTTTTTATTTTTCTTTTTGC GFPF ATGGTGAGCAAGGGCGAGGAGCTGT GFPR CCTTTTTTGCCGGACTGCAGCTTGTACAGCTCGTCCATG
Primers for PCR: F TTCGCTAAGGATGATTTCTGGAATTC R CCTTTTTTGCCGGACTGCAGCTTGTACAGCTCGTCCATG
Primers for sequencing: F TTCGCTAAGGATGATTTCTGGAATTC R CTTGTACAGCTCGTCCATG
Fig.1 PCR result. We extracted plasmids from the bacteria solution which shows correct sequencing result, and 1%agarose gel electrophoresis was performed to validate the PCR production of the fusion segment that has inserted between the restriction sites EcoRI and PstI. The primers for PCR are as above.
Fig.2 Sequencing result of the recombinant plasmid. The primers for sequencing are as above. You can click here to download the sequence files.
Fig.3 Transfection cells observed under a fluorescence microscope. 293T cells were seeded 7.5×105 per well in the 6 well plate, and transfection was performed following the protocol of Invitrogen Lipofectamine™ 3000 Transfection Reagent when cells grow to 70-80% of the wells. We added 4mM theophylline (solved in PBS) into the experimental group according to the article mentioned above while equivoluminal PBS to control group 4h after transfection. the Fluorescence was observed 24h after the transfection.
In conclusion, this result well confirmed that CMV+riboswitches+eGFP transformant certainly can be used to control and show the expression of the gene of interest in eukaryu.
[1] Bell, C.L., et al., Control of alphavirus-based gene expression using engineered riboswitches. Virology, 2015. 483: p. 302-311.
Design Notes
The CMV+riboswitches+eGFP was linked into the expression vector between the restriction sites EcoRI and PstI using the Multiple fragment homologous recombination.
Source
The CMV promoter and eGFP was cloned from other plasmids,and the riboswitch was artificially synthesized.