Difference between revisions of "Part:BBa K2973012"

Latest revision as of 12:56, 21 October 2019

Toehold 14 β-Lactamase Dictyoglomus turgidum

This composite part consists of T7 Promoter (BBa_J64997) and T7 Terminator (BBa_K731721), the Ribosomal Binding Site (AGAGGAGA), a Toehold switch and the CDS of the β-lactamase without the signal peptide. Toehold switch systems are composed of two RNA strands referred to as the switch and trigger. The switch RNA contains the coding sequence of the regulated β-lactamase gene. Upstream of this coding sequence is a hairpin-based processing module containing both a strong RBS and a start codon that is followed by a common 21 nt linker sequence coding for low-molecular-weight amino acids added to the N terminus of the gene of interest. A single-stranded toehold sequence at the 5’ end of the hairpin module provides the initial binding site for the trigger RNA strand. This trigger molecule contains an extended single-stranded region that completes a branch migration process with the hairpin to expose the RBS and start codon, thereby initiating translation of the β-lactamase. This toehold was designed to detect the short 16S rRNA sequence GAGCGAGATGCTCAGGTAAGGAAAGGGTATAGAGGG of Dictyoglomus turgidum. β-lactamase (EC 3.5.2.6) is a small monomeric enzyme(29kDa) that is produced by bacteria and gives them resistance to antibiotics with the β-lactam ring because of its ability to hydrolyze the amide bond in the β-lactam ring. This ability can be exploited in order to use β-lactamase as a protein reporter by providing the enzyme with its chromogenic substrate Nitrocefin. Nitrocefin is a chromogenic cephalosporin first reported in 1972 as a novel and straightforward substrate used to detect bacteria resistant to β-lactam antibiotics. Normally, a nitrocefin solution has a yellow color, but after its hydrolysis by β-lactamase, the color of the solution turns red, allowing in that way the detection of the enzyme.

Usage and Biology

A key aspect of our project is to provide a tool that can detect the DNA of any organism easily and reliably. To that end, we designed, a pool of universal toehold switches from hyperthermophile bacteria ,in silico. One of them was Toehold No.14. The reporter gene attached to the toehold switch is β-lactamase.

To assess the new toehold's performance, we performed a series of in vitro protein synthesis reactions. The in vitro transcription/ translation reactions were done using the PURExpress® In Vitro Protein Synthesis kit. To reduce the cost of the reaction, we lowered the reaction volume from 25 to 7 μL. The incubation time was 3 hours at 37 ℃ . The major issue with toehold switches is their leakiness (translation in absence of trigger sequence), so we tested only one trigger concentration.

As seen in Figure 1, the signal produced by Toehold 14 is very similar to that of the positive control. However, when no trigger sequence is added, the signal produced is the same, if not higher, than the 100nM trigger condition. This can be interpreted as a lack of regulation of translation by the riboswitch. That means that the toehold switch has an open conformation and thus an accessible RBS, even when no trigger is added.

Figure 1: Bars show the ability of toehold 14 to hydrolyze nitrocefin.

Sequence and Features