Difference between revisions of "Part:BBa K3254003"

 
 
(7 intermediate revisions by one other user not shown)
Line 5: Line 5:
 
We expected that this part can be placed between a promoter and a translational unit part and work as a normally open (NO) switch for the downstreamed gene. and switch to ON state by excising the terminator ECK120030221 between the att sites when it reacted with Int8 integrase (BBa_K3254008). Two BsaI restriction site were added between attB site and terminator. As a result, it can work as a normally closed (NC) switch for the gene which was inserted between the two BsaI site and switch to OFF state when it was excised.  
 
We expected that this part can be placed between a promoter and a translational unit part and work as a normally open (NO) switch for the downstreamed gene. and switch to ON state by excising the terminator ECK120030221 between the att sites when it reacted with Int8 integrase (BBa_K3254008). Two BsaI restriction site were added between attB site and terminator. As a result, it can work as a normally closed (NC) switch for the gene which was inserted between the two BsaI site and switch to OFF state when it was excised.  
  
<!-- Add more about the biology of this part here
+
=Usage and Biology=
===Usage and Biology===
+
==Visual Result as a Normally Open Switch==
 +
*We conducted a simple test to see if our design met the expection.
 +
 
 +
===Experimental Setup===
 +
*Genetic design principle of the experimental group was described on the page of [[Part:BBa_K3254012|BBa_K3254012]].
 +
*A P15A-AmpR plasmid was co-transfered into the E.coli DH5α host cell with the reporter plasmid containing this part as the negative control.
 +
*Single colonies were selected from the experimental LB-agar plate and negative control LB-agar plate, then inoculated into EP tubes with 500 μL M9 supplemented medium for overnight growth at 37 °C and 200 rpm.
 +
*Tubes were centrifuged at 10000g for 1 min. Then observed the GFP fluorescence of the cell precipitations under blue light.
 +
*M9 medium (supplemented): 6.8 g/L Na<sub>2</sub>HPO<sub>4</sub>, 3 g/L KH<sub>2</sub>PO<sub>4</sub>, 0.5 g/L NaCl, 1 g/L NH<sub>4</sub>Cl, 0.34 g/L thiamine, 0.2% casamino acids, 0.4% glucose, 2mM MgSO<sub>4</sub>, and 100 μM CaCl<sub>2</sub>.
 +
 
 +
===Results===
 +
*IBR-[[Part:BBa_K3254000|C35]]/[[Part:BBa_K3254001|F55]]/[[Part:BBa_K3254002|S37]]/[[Part:BBa_K3254003|E21]]/[[Part:BBa_K3254004|T25]]/[[Part:BBa_K3254005|G22]] indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respectively.
 +
*We observed the GFP fluorescence from the experimental tube as expected.<br>
 +
 
 +
[[File:T--GENAS_China--primary_screening.png|600px|thumb|center|Visual Results as Normally Open Switches]]<br>
 +
 
 +
==Quantitative Characterization of the Normally Open Switch==
 +
 
 +
===Experimental Setup===
 +
*Bacteria harboring the circuits (see the top part of the result image) first inoculated from single colonies into a flat-bottom 96-well plate for overnight growth. Then, the cell cultures were diluted 1000-fold with M9 supplemented medium growth for another 20 hours. All incubations were carried out using a Digital Thermostatic Shaker maintained at 37 °C and 1000 rpm, using flat-bottom 96-well plates sealed with sealing film. Finally, 3-μL samples each culture were transferred to a new 96-well plate containing 200 μL per well of PBS supplemented with 2 mg/mL kanamycin.
 +
*The fluorescence distribution of each sample was assayed using a flow cytometry. The arithmetical mean of each sample was determined using FlowJo software.
 +
*The principle of data processing is shown on the result image.
 +
 
 +
===Results===
 +
*IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respectively.
 +
*Compared to other parts, this part performed well.<br>
 +
 
 +
[[File:T--GENAS_China--primary_quantitative_characterization.png|600px|thumb|center|Quantitative Characterization of the Normally Open Switches]]<br>
 +
 
 +
==Visual Results as a Normally Closed Switch and Toggle Switch==
 +
*We inserted an [[Part:BBa_E2060|mCherry]] translational unit between the two BsaI sites.
 +
*Other experiment setup were the same with "Visual Result as a Normally Closed Switch".
 +
 
 +
===Results===
 +
*The normally open switch function well.
 +
*At the same time, the downstreamed GFP also expressed well which indicated this part can also function as a toggle switch.
 +
[[File:T--GENAS_China--INT8_NC_switch.png]]
 +
 
 +
==Orthogonality Characterization==
 +
 
 +
===Genetic Design===
 +
*The composition and principle of the experimental system are indicated below.
 +
 
 +
[[File:T--GENAS_China--excision_with_backbone. PNG|200px|thumb|left|The composition and principle of the experimental system]]
 +
 
 +
===Experimental Setup===
 +
The reporter plasmid contained this part were co-transferred into E.coli DH5α host with 6 integrase generator plasmids.
 +
Then single colonies were inoculated into M9 supplemented medium for overnight growth. Then, the cell cultures were diluted 1000-fold with M9 supplemented medium with 500 μM IPTG inducer and growth for another 20 hours. All incubations were carried out using a Digital Thermostatic Shaker maintained at 37 °C and 1000 rpm, using flat-bottom 96-well plates sealed with sealing film. Finally, The cultures were sampled for genotype PCR testing.
 +
The principle of genotype identification was shown on the right of results image.
 +
 
 +
===Results===
 +
*IBR-E21 was the plasmid containing this part.
 +
*The result indicates that this part can only be recombined by int8 integrase.
 +
*The sequence (attL or attR) after recombination is CAATCATCAGATAACTATGGCGGCACGTGCATTAATGTTGAGTGAACAAACTTCCATAATAAAAT.
 +
 
 +
[[File:T--GENAS_China--orthogonality_test.png]]
 +
 
  
<!-- -->
 
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K3254003 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K3254003 SequenceAndFeatures</partinfo>

Latest revision as of 12:34, 21 October 2019


Int8attB-BsaI site-terminator-Int8attP

We expected that this part can be placed between a promoter and a translational unit part and work as a normally open (NO) switch for the downstreamed gene. and switch to ON state by excising the terminator ECK120030221 between the att sites when it reacted with Int8 integrase (BBa_K3254008). Two BsaI restriction site were added between attB site and terminator. As a result, it can work as a normally closed (NC) switch for the gene which was inserted between the two BsaI site and switch to OFF state when it was excised.

Usage and Biology

Visual Result as a Normally Open Switch

  • We conducted a simple test to see if our design met the expection.

Experimental Setup

  • Genetic design principle of the experimental group was described on the page of BBa_K3254012.
  • A P15A-AmpR plasmid was co-transfered into the E.coli DH5α host cell with the reporter plasmid containing this part as the negative control.
  • Single colonies were selected from the experimental LB-agar plate and negative control LB-agar plate, then inoculated into EP tubes with 500 μL M9 supplemented medium for overnight growth at 37 °C and 200 rpm.
  • Tubes were centrifuged at 10000g for 1 min. Then observed the GFP fluorescence of the cell precipitations under blue light.
  • M9 medium (supplemented): 6.8 g/L Na2HPO4, 3 g/L KH2PO4, 0.5 g/L NaCl, 1 g/L NH4Cl, 0.34 g/L thiamine, 0.2% casamino acids, 0.4% glucose, 2mM MgSO4, and 100 μM CaCl2.

Results

  • IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respectively.
  • We observed the GFP fluorescence from the experimental tube as expected.
Visual Results as Normally Open Switches

Quantitative Characterization of the Normally Open Switch

Experimental Setup

  • Bacteria harboring the circuits (see the top part of the result image) first inoculated from single colonies into a flat-bottom 96-well plate for overnight growth. Then, the cell cultures were diluted 1000-fold with M9 supplemented medium growth for another 20 hours. All incubations were carried out using a Digital Thermostatic Shaker maintained at 37 °C and 1000 rpm, using flat-bottom 96-well plates sealed with sealing film. Finally, 3-μL samples each culture were transferred to a new 96-well plate containing 200 μL per well of PBS supplemented with 2 mg/mL kanamycin.
  • The fluorescence distribution of each sample was assayed using a flow cytometry. The arithmetical mean of each sample was determined using FlowJo software.
  • The principle of data processing is shown on the result image.

Results

  • IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respectively.
  • Compared to other parts, this part performed well.
File:T--GENAS China--primary quantitative characterization.png
Quantitative Characterization of the Normally Open Switches

Visual Results as a Normally Closed Switch and Toggle Switch

  • We inserted an mCherry translational unit between the two BsaI sites.
  • Other experiment setup were the same with "Visual Result as a Normally Closed Switch".

Results

  • The normally open switch function well.
  • At the same time, the downstreamed GFP also expressed well which indicated this part can also function as a toggle switch.

T--GENAS China--INT8 NC switch.png

Orthogonality Characterization

Genetic Design

  • The composition and principle of the experimental system are indicated below.
File:T--GENAS China--excision with backbone. PNG
The composition and principle of the experimental system

Experimental Setup

The reporter plasmid contained this part were co-transferred into E.coli DH5α host with 6 integrase generator plasmids. Then single colonies were inoculated into M9 supplemented medium for overnight growth. Then, the cell cultures were diluted 1000-fold with M9 supplemented medium with 500 μM IPTG inducer and growth for another 20 hours. All incubations were carried out using a Digital Thermostatic Shaker maintained at 37 °C and 1000 rpm, using flat-bottom 96-well plates sealed with sealing film. Finally, The cultures were sampled for genotype PCR testing. The principle of genotype identification was shown on the right of results image.

Results

  • IBR-E21 was the plasmid containing this part.
  • The result indicates that this part can only be recombined by int8 integrase.
  • The sequence (attL or attR) after recombination is CAATCATCAGATAACTATGGCGGCACGTGCATTAATGTTGAGTGAACAAACTTCCATAATAAAAT.

T--GENAS China--orthogonality test.png


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 79
    Illegal BsaI.rc site found at 67