Difference between revisions of "Part:BBa K2715011"
Jabbott1999 (Talk | contribs) (→Characterisation) |
Jabbott1999 (Talk | contribs) (→Characterisation) |
||
| Line 29: | Line 29: | ||
>Pfdx: gtgtagtagcctg<strong>C</strong>gaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagataggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt | >Pfdx: gtgtagtagcctg<strong>C</strong>gaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagataggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt | ||
| − | >Bba_K2715011: gtgtagtagcctg<strong>T<strong>gaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagataggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt | + | >Bba_K2715011: gtgtagtagcctg<strong>T</strong>gaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagataggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt |
<br> | <br> | ||
Revision as of 11:49, 21 October 2019
Constitutive promoter from C.sporogenes ferrodoxin gene
Usage and Biology
This basic part is the promoter portion of the ferredoxin regulatory region from the Gram-positive organism Clostridium sporogenes. Ferredoxins (from Latin ferrum: iron + redox, often abbreviated "fdx") are iron–sulfur proteins that mediate electron transfer in a range of metabolic reactions, and the ferredoxin gene is known is to highly expressed in C. sporogenes. This promoter has been demonstrated previously to be a strong promoter in clostridial species (ref).
Characterisation
This basic part was characterised as part of a composite part, and used as a promoter which functions in both the Gram-negative E. coli and the Gram-positive Clostridium difficile. The full native regulatory region driving thiolase expression in C. sporogenes is composed of this ferredoxin promoter BBa_K2715011 and it's RBS BBa_K2715020. It's strength was assessed in E. coli using GFP as a reporter gene, the link to the characterisation data is provided below. A composite part was also assembled using gusA as a reporter gene, and this was used to assay its strength in Clostridium difficile. The composite part driving gusA is also listed below:
GFP assay:
BBa_K2715002
GUS assay:
Nottingham iGEM2019: Characterisation of Pfdx with FAST in comparison with other Clostridium reporters.
One of the goals of goal of this experiment was to characterize the Pfdx promoter with a new reporter protein, Fluorescent Activating Substrate Transporter (FAST). FAST is a protein that becomes fluorescent once bound to a fluorogenic ligand. Its main advantage is to be effective in absence of molecular oxygen (contrarily to standard fluorescent reporters such as GFP), which makes it compatible with work in Clostridium. The part was characterized through a fluorescence assay in E. coli as well as in C. sporogenes. Fluorescence is reported as Molecule Equivalent Fluorescence per Particle (MEFL/particle) as per the recommendation of the iGEM measurement Hub.
Additionally, while preparing the assay we also discovered a mistake in the BBa K2715011 part sequence: this part was described as the native Pfdx promoter from C. sporogenes, but exhibited a point mutation compared to the Wild-Type strain (C14T). The mutation looked benign (190 bp away from START codon), but we decided to compare the registry part to the Wild-Type Pfdx sequence to prove that both the Wild-Type and the registry version of the Pfdx promoter were equivalent. The sequence of each part is given here for convenience, with the mismatch bolded:
>Pfdx: gtgtagtagcctgCgaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagataggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt
>Bba_K2715011: gtgtagtagcctgTgaaataagtaaggaaaaaaaagaagtaagtgttatatatgatgattattttgtagatgtagataggataatagaatccatagaaaatataggttatacagttatataaaaattactttaaaaattaataaaaacatggtaaaatataaatcgt
BBa_K2715026
The first observation from the expression of the FAST protein using different Clostridium and E. coli promoters is that FAST is a suitable reporter gene, both in E. coli and in Clostridium Sporogenes. Indeed, quantifiable levels of fluorescence were recorded in between 6.3*103 MEFL/particle and 1.1*106 MEFL/particle. Pfdx is the strongest of the promoters tested in E. coli after Pthl, and the strongest in C. sporogenes.
Pfdx and Bba_K2715011 have equivalent expression levels (5.5*105 +- 0.9*105 MEFL/particle and 6*105 +-1*105 MEFL/particle respectively in C. sporogenes; 9*105 +- 1*105 105 MEFL/particle and 1.007*106 +-0.009*106 105 MEFL/particle respectively in E. coli). As such, Pfdx and Bba_K2715011 are interchangeable. However, since our part “Pfdx” is the original, unmutated version of the ferredoxin promoter from C. sporogenes, the sequence of Bba_K2715011 documented in the registry of parts should be curated to match the native sequence of Pfdx.
For more characterisation details, please see the Results page.
https://2019.igem.org/Team:Nottingham/Results
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
References
Heap, J.T., Pennington, O.J., Cartman, S.T. and Minton, N.P., 2009. A modular system for Clostridium shuttle plasmids. Journal of microbiological methods, 78(1), pp.79-85.
Davis, D.F., Ward, W.W. and Cutler, M.W., 1994. Posttranslational chromophore formation in recombinant GFP from E. coli requires oxygen. In Bioluminescence and Chemiluminescence: Fundamentals and Applied Aspects. Proceedings of the 8th International Symposium on Bioluminescence and Chemiluminescence, Cambridge. Wiley, New York, NY (pp. 569-599).
Chiu, N.H. and Watson, A.L., 2017. Measuring β‐Galactosidase Activity in Gram‐Positive Bacteria Using a Whole‐Cell Assay with MUG as a Fluorescent Reporter. Current protocols in toxicology, 74(1), pp.4-44.