Difference between revisions of "Part:BBa K2924006"

Revision as of 14:59, 20 October 2019

guideRNA from acetyl coenzyme A acetyltransferase

acetyl coenzyme A acetyltransferase (thiolase) phaA guide RNA of Synechocystis sp.

Usage and Biology

This part contains the acetyl coenzyme A acetyltransferase guide RNA of Synechocystis sp. PCC 6803. It was used for an induced knock-down of phaA with a CRISPRi/dCas9-system, which was kindly provided by Yao et al. (2015)¹. The acetyl coenzyme A acetyltransferase can be found under the UniProt ID: THIL_SYNY3² and is involved in fatty acid degradation and fatty acid metabolism³. The gene is positioned in the genome at 1435842 - 1437071 (1230 bp) bases ³. he guide RNA was obtained by using the CRISPR guide from benchling⁴. The sgRNA in the gene is located at 255 - 274 bp in the + strand (Fig. 1). The sequence of the sgRNA is ggcggagattcccgatacgg, has an On-Target Score of 66.3 and an Off-Target Score of 49.9.

Fig. 1: Position of sgRNA (orange) in the acetyl coenzyme A acetyltransferase gene.

Fig. 2: <i> Reaction scheme of the formation of acetoacetyl CoA by thiolase

Thiolase is an enzyme in the mevalonate pathway, which converts two units of acetyl-CoA to acetoacetyl CoA. It catalyzes the carbon–carbon-bond formation, which is an essential step in the biosynthetic pathways of e.g. fatty acids through thioester-dependent Claisen condensation reaction mechanism (Fig. 2)⁵.

The short guide RNA was cloned into a vector containing a neutral site of Synechocystis sp. PCC 6803. That’s a homologous sequence of its genome to ensure a knock-in into the genome (Fig. 3)¹.

Due to the created knock-in containing a resistance for antibiotic in close proximity to the sgRNA, the target enzyme can e down-regulated with a CRISPRi/dCas9 - system ¹. This system is induced by anhydrotetracycline (aTc) that activates the synthesis of the dCas9, which then binds to the sgRNA. The formed complex is able to bind complementary to the targeted gene and stops the transcription of it (Fig. 4).

Fig. 3: Scheme of a knock-in as a consequence of homologous recombination in Synechocystis.

Fig. 4: Scheme of function of the CRISPRi/dCas9 - system. The dCas9 (yellow) binds with the sgRNA to the complementary DNA strand and inhibits the transcription by RNA polymerase II (blue).

Sequence and Features