Difference between revisions of "Part:BBa K2924008"

Revision as of 14:15, 20 October 2019

guideRNA from beta ketoacyl-acyl carrier protein synthase

beta ketoacyl-acyl carrier protein synthase fabF guide RNA of Synechocystis sp.</i

This part contains the beta ketoacyl-acyl carrier protein synthase guide RNA of <i>Synechocystis sp. PCC 6803. It was used to create an induced knock-down of fabF via CRISPRi/dCas9-system, which was kindly provided Yao et al. (2015)¹. The beta ketoacyl-acyl carrier protein synthase can be found under the UniProt ID: FABF_SYNY3² and is involved in fatty acid biosynthesis and fatty acid metabolism³. The gene is positioned in the genome at 1669119 - 1670333 (1215 bp) bases ³. he guide RNA was obtained by using the CRISPR guide from benchling⁴. The sgRNA in the gene is located at 265 - 284 bp in the + strand (Fig. 1). The sequence of the sgRNA is gatcccgctgaacaaccctg, has anOn-Target Score of 72.8 and an Off-Target Score of 50.0.

Fig. 1: Position of sgRNA (orange) in the beta ketoacyl-acyl carrier protein synthase gene.

Fig. 2: Reaction catalyzed by ketoacyl-acyl carrier protein synthase.

The beta ketoacyl-acyl carrier protein synthase (FabF) is an enzyme participating in the fatty acid metabolism of different organisms such as plants or bacteria. It catalyzes the condensation during fatty acid synthesis by forming a carbon bond between Malonyl-ACP to an acyl acceptor of the acyl-[acyl-carrier-protein] (Fig. 2)⁵.

The short guide RNA (sgRNA) was cloned into a vector containing a neutral site of Synechocystis sp. PCC 6803. That’s a homologous sequence of its genome to ensure a knock-in into the genome (Fig. 3)¹.

In a general overview, the knock-in part contains a resistance for antibiotic and the sgRNA, which can be down-regulated by CRISPRi/dCas9 - system. This system is induced by anhydroTetracycline (aTc), which activates the synthesis of the dCas9, which is then binding to the sgRNA. These complex is able to bind complementary to the targeted enzyme and stops the transcription of it (Fig. 4).

Fig. 3: Scheme of a knock-in as a consequence of homologous recombination in Synechocystis.

Fig. 4: Scheme of function of the CRISPRi/dCas9 - system. The dCas9 (yellow) binds with the sgRNA to the complementary DNA strand and inhibits the transcription by RNA polymerase II (blue).

Sequence and Features