Difference between revisions of "Part:BBa K2924014"

Revision as of 13:34, 20 October 2019

guideRNA from mVenus

mVenus guide RNA

Usage and Biology

Fig. 1: Position of sgRNA (orange) in the mVenus gene.

This part contains guide RNA of mVenus, a fluorescent protein, which originates from Aequorea victoria and is an improved variant of YFP, which folds faster and more efficiently ¹. It was used for an induced knock-down with a CRISPRi/dCas9-system, which was kindly provided by Yao et al. (2015)². The guide RNA was obtained by using the CRISPR guide from benchling³. The sgRNA in the gene is located at 52-71 bp in the + strand (Fig. 1). The sequence of the sgRNA is GAATTGGATGGTGATGTGAA has anOn-Target Score of 70.2 and an Off-Target Score of 100.0.

The mVenus sgRNA was cloned into a vector containing a neutral site of Synechocystis sp. PCC 6803. That’s a homologous sequence of its genome to ensure a knock-in into the genome (Fig.. 2)².

Due to this knock-in containing a resistance for antibiotic and the sgRNA, we can down-regulate the target enzyme with a CRISPRi/dCas9 - system². This system is induced by anhydrotetracycline (aTc), which activates the synthesis of the dCas9, which is then binding to the sgRNA. These complex is able to bind complementary to the targeted enzyme and stops the transcription of it (Fig. 3).

Fig. 2: Scheme of a knock-in as a consequence of homologous recombination in Synechocystis.

Fig. 3: Scheme of function of the CRISPRi/dCas9 - system. The dCas9 (yellow) binds with the sgRNA to the complementary DNA strand and inhibits the transcription by RNA polymerase II (blue).

Sequence and Features