Difference between revisions of "Part:BBa K2983011"
 
(6 intermediate revisions by 2 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K2983011 short</partinfo>
 
<partinfo>BBa_K2983011 short</partinfo>
  
−
This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites.
+
This part is a Loop Type IIS Golden Gate adapter that contains a BsaI and a SapI restriction sites.
  
 
===Usage and Biology===
 
===Usage and Biology===
 +
[[File:T--Evry Paris-Saclay--Loop-Sites.png|300px|thumb| Figure 1. BsaI and SapI restriction sites (adapted from [1])]]
 +
The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1 and 2).
  
−
The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the Loop F-Beta is as fellow : GGTCTCACGCTAGCATGAAGAGC
 
  
−
[[File:T--Evry Paris-Saclay--Loop F-Beta.png|300px|thumb|left| Figure1: Loop F-Beta structure]]
 
  
  
−
Blue triangle: SapI fixation site (GAAGAGC)
 
  
−
Red triangle : BsaI fixation site (GGTCTC)
 
  
−
Blue circle : overhang formed by SapI after cutting (GCA)
 
  
−
Yellow circle: overhang formed by BasI  after cutting  (CGCT)
 
  
  
 +
 +
 +
 +
 +
 +
 +
A total of 50 combinations are theoretically possible and this part is one of them: the loop F-Beta (Figure 2).
 +
 +
[[File:T--Evry Paris-Saclay--Loop F-Beta.png|300px|thumb|left| Figure 2. Loop F-Beta structure]]
 +
 +
 +
Blue triangle: SapI fixation site (GCTCTTC) on the complementary strand
 +
 +
Red triangle: BsaI fixation site (GGTCTC)
 +
 +
Blue circle: overhang formed by SapI after cutting (GCA)
 +
 +
Yellow circle: overhang formed by BsaI after cutting (CGCT)
 +
 +
 +
 +
 +
 +
This part was used to define the Loop assembly system dedicated to the oleaginous yeast ''Yarrowia lipolytica'' (for details visit https://2019.igem.org/Team:Evry_Paris-Saclay/Design).
 +
 +
===References===
 +
 +
[1] Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.
  
  

Latest revision as of 18:05, 19 October 2019


Loop F-Beta

This part is a Loop Type IIS Golden Gate adapter that contains a BsaI and a SapI restriction sites.

Usage and Biology

Figure 1. BsaI and SapI restriction sites (adapted from [1])

The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1 and 2).








A total of 50 combinations are theoretically possible and this part is one of them: the loop F-Beta (Figure 2).

Figure 2. Loop F-Beta structure


Blue triangle: SapI fixation site (GCTCTTC) on the complementary strand

Red triangle: BsaI fixation site (GGTCTC)

Blue circle: overhang formed by SapI after cutting (GCA)

Yellow circle: overhang formed by BsaI after cutting (CGCT)



This part was used to define the Loop assembly system dedicated to the oleaginous yeast Yarrowia lipolytica (for details visit https://2019.igem.org/Team:Evry_Paris-Saclay/Design).

References

[1] Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 9
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 1
    Illegal SapI.rc site found at 17