Difference between revisions of "Part:BBa K2983022"

Revision as of 14:04, 19 October 2019

Loop C-Alpha

This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites.

Usage and Biology

The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the loop C-Alpha is as fellow : GGTCTCAAATGAATGTGAAGAGC

Figure 1:Loop C-Alpha structure

Blue triangle: SapI fixation site (GCTCTTC)

Red triangle : BsaI fixation site (GAGACC)

Blue circle : overhang formed by SapI after cutting (ATG)

Orange circle: overhang formed by BasI after cutting (AATG)

Sequence and Features