Difference between revisions of "Part:BBa K142040:Design"
(→‎Design Notes)
 
(2 intermediate revisions by the same user not shown)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
−
RMF was amplified from E. coli, therefore sequence optimization was unnecessary. The RMF gene does not contain any restriction sites for EcoRI, XbaI, SpeI or PstI and could be turned into a BioBrick without further modification.
+
RMF was amplified from E. coli genomic DNA, therefore sequence optimization was unnecessary. The RMF gene does not contain any restriction sites for EcoRI, XbaI, SpeI or PstI and was turned into a BioBrick without further modification.
−
 
+
−
 
+
  
 
===Source===
 
===Source===
Line 24: Line 22:
  
 
===References===
 
===References===
 +
(1) Wada, A., Yamazaki, Y., Fujita, N., and Ishihama, A. (1990) Structure and probable genetic location of a "ribosome modulation factor" associated with 100S ribosomes in stationary-phase Escherichia coli cells. Proc Natl Acad Sci U S A 87, 2657-61.
 +
 +
(2) Ueta, M., Ohniwa, R. L., Yoshida, H., Maki, Y., Wada, C., and Wada, A. (2008) Role of HPF (hibernation promoting factor) in translational activity in Escherichia coli. J Biochem 143, 425-33.
 +
 +
(3) Yamagishi, M., Matsushima, H., Wada, A., Sakagami, M., Fujita, N., and Ishihama, A. (1993) Regulation of the Escherichia coli rmf gene encoding the ribosome modulation factor: growth phase- and growth rate-dependent control. Embo J 12, 625-30.
 +
 +
(4) Wada, A., Igarashi, K., Yoshimura, S., Aimoto, S., and Ishihama, A. (1995) Ribosome modulation factor: stationary growth phase-specific inhibitor of ribosome functions from Escherichia coli. Biochem Biophys Res Commun 214, 410-7.
 +
 +
(5) El-Sharoud, W. M., and Niven, G. W. (2007) The influence of ribosome modulation factor on the survival of stationary-phase Escherichia coli during acid stress. Microbiology 153, 247-53.
 +
 +
(6) Yoshida, H., Maki, Y., Kato, H., Fujisawa, H., Izutsu, K., Wada, C., and Wada, A. (2002) The ribosome modulation factor (RMF) binding site on the 100S ribosome of Escherichia coli. J Biochem 132, 983-9.
 +
 +
(7) Tang, Y., Rossi, P.,  Swapna, G.,  Wang, H.,  Jiang, M.,  Cunningham, K.,  Owens, L.,  Ma, L.,  Xiao, R.,  Liu, J.,  Baran, M.C.,  Acton, T.B.,  Rost, B.,  Montelione, G.T. . (2007) Solution NMR Structure of Ribosome Modulation Factor VP1593 from Vibrio parahaemolyticus. Unpublished work.
 +
 +
(8) Yoshida, H., Yamamoto, H., Uchiumi, T., and Wada, A. (2004) RMF inactivates ribosomes by covering the peptidyl transferase centre and entrance of peptide exit tunnel. Genes Cells 9, 271-8.

Latest revision as of 15:06, 17 October 2008

ribosome modulation factor (RMF)


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 55
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

RMF was amplified from E. coli genomic DNA, therefore sequence optimization was unnecessary. The RMF gene does not contain any restriction sites for EcoRI, XbaI, SpeI or PstI and was turned into a BioBrick without further modification.

Source

The nucleotide sequence of RMF from Escherichia coli MG1655 was obtained from GenBank and used for primer design. Amplification from DH5-alpha genomic DNA template and addition of BioBrick standard prefix and suffix RMF was performed by PCR using the following primers:

forward primer 5'-cgcggaattcgcggccgcttctagatgaagagacaaaaacgagatcgcctgg

reverse primer 5'-cgcgctgcagcggccgctactagtattattaggccattactaccctgtccgc

The PCR product was subcloned into vector pSB1A7.

References

(1) Wada, A., Yamazaki, Y., Fujita, N., and Ishihama, A. (1990) Structure and probable genetic location of a "ribosome modulation factor" associated with 100S ribosomes in stationary-phase Escherichia coli cells. Proc Natl Acad Sci U S A 87, 2657-61.

(2) Ueta, M., Ohniwa, R. L., Yoshida, H., Maki, Y., Wada, C., and Wada, A. (2008) Role of HPF (hibernation promoting factor) in translational activity in Escherichia coli. J Biochem 143, 425-33.

(3) Yamagishi, M., Matsushima, H., Wada, A., Sakagami, M., Fujita, N., and Ishihama, A. (1993) Regulation of the Escherichia coli rmf gene encoding the ribosome modulation factor: growth phase- and growth rate-dependent control. Embo J 12, 625-30.

(4) Wada, A., Igarashi, K., Yoshimura, S., Aimoto, S., and Ishihama, A. (1995) Ribosome modulation factor: stationary growth phase-specific inhibitor of ribosome functions from Escherichia coli. Biochem Biophys Res Commun 214, 410-7.

(5) El-Sharoud, W. M., and Niven, G. W. (2007) The influence of ribosome modulation factor on the survival of stationary-phase Escherichia coli during acid stress. Microbiology 153, 247-53.

(6) Yoshida, H., Maki, Y., Kato, H., Fujisawa, H., Izutsu, K., Wada, C., and Wada, A. (2002) The ribosome modulation factor (RMF) binding site on the 100S ribosome of Escherichia coli. J Biochem 132, 983-9.

(7) Tang, Y., Rossi, P., Swapna, G., Wang, H., Jiang, M., Cunningham, K., Owens, L., Ma, L., Xiao, R., Liu, J., Baran, M.C., Acton, T.B., Rost, B., Montelione, G.T. . (2007) Solution NMR Structure of Ribosome Modulation Factor VP1593 from Vibrio parahaemolyticus. Unpublished work.

(8) Yoshida, H., Yamamoto, H., Uchiumi, T., and Wada, A. (2004) RMF inactivates ribosomes by covering the peptidyl transferase centre and entrance of peptide exit tunnel. Genes Cells 9, 271-8.