Difference between revisions of "Part:BBa K2918061"

(Strain Construction)
Line 16: Line 16:
  
 
===Strain Construction===
 
===Strain Construction===
The DNA sequence of the part was synthesized by IDT with flanking BsaI sites and AATG 3' overhang. The RBS was then cloned along with an altered ribozyme [https://parts.igem.org/Part:BBa_K2918012/ RiboJ] in a level 0 MoClo backbone [http://www.addgene.org/47992/ pICH41246] and the sequence was confirmed by sequencing. The cloning protocol can be found in the modular cloning section below. Click <html><a href="http://2019.igem.org/Team:TUDelft/Experiments" target="_blank">here</a>.</html> for the detailed protocol.  
+
The DNA sequence of the part was synthesized by IDT with flanking BsaI sites and AATG 3' overhang. The RBS was then cloned along with an altered ribozyme [https://parts.igem.org/Part:BBa_K2918012/ RiboJ] in a level 0 MoClo backbone [http://www.addgene.org/47992/ pICH41246] and the sequence was confirmed by sequencing. The cloning protocol can be found in the modular cloning section below. Click <html><a href="http://2019.igem.org/Team:TUDelft/Experiments" target="_blank">here</a>.</html> for the detailed protocol.
 
+
 
+
  
 
===References===
 
===References===

Revision as of 08:45, 15 October 2019

Φ29 Right origin of replication (OriR)

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Usage and Biology

Many promoter parts contain sequences downstream of the Transcription Start Site (such as operators or assembly fusion sites) resulting in extra unintended sequences in the transcript. These additional sequences are shown to significantly affect gene expression levels, disrupting the modularity and predictability of synthetic parts (Lou et al., 2012)). Therefore, to insulate the translation rates of the part from the use of different promoters, ribozymes can be used for their self cleavage properties and remove these sequences upstream of mRNA. By the inclusion of ribozymes in 5’ UTR parts, outputs of genetic circuits will be insulated from genetic context, but the presence of multiple copies of the same ribozyme in different genes may result in homologous recombination (Lou et al., 2012)). With that in mind, we, from TU Delft 2019, have designed Type IIS parts of both ribozymes and RBS for modular assembly in any combination desired.

Unfortunately, junction sequences such as Type IIS overhangs between ribozyme and RBS can also influence translation rates. To achieve scarless modular cloning of ribozymes and RBS, the strategy illustrated below can be adopted.


Lou et al have screened and identified a series of ribozymes for insulating genetic circuits. All of these ribozymes contain conserved 3’ ends (ACCTCTACAAATAATTTTGTTTAA) and the 4 highlight nucleotides can be used as a fusion site identified as compatible to Type IIS cloning. In the RBS sequence, AA should be added upstream in order to complement the incomplete ribozyme sequence when assembled.


Strain Construction

The DNA sequence of the part was synthesized by IDT with flanking BsaI sites and AATG 3' overhang. The RBS was then cloned along with an altered ribozyme RiboJ in a level 0 MoClo backbone [http://www.addgene.org/47992/ pICH41246] and the sequence was confirmed by sequencing. The cloning protocol can be found in the modular cloning section below. Click here. for the detailed protocol.

References