|
|
| (2 intermediate revisions by the same user not shown) |
| Line 10: |
Line 10: |
| | <span class='h3bb'>Sequence and Features</span> | | <span class='h3bb'>Sequence and Features</span> |
| | <partinfo>BBa_J100034 SequenceAndFeatures</partinfo> | | <partinfo>BBa_J100034 SequenceAndFeatures</partinfo> |
| − | === Promoters and Their Primers ===
| |
| − | '''
| |
| − | Several promoters with high expression level that are commonly used in Bacillus subtilis were screened to determine the most efficient ones for our experiments on the construction of biological parts. Three of such promoters, Groe (BBa J100034), SecA ([https://parts.igem.org/Part:BBa_K1469002 BBa K1469002]), P43 ([https://parts.igem.org/Part:BBa_K208002 BBa K208002]), exist in the iGEM registry already.Here we only show the data of Groe(BBa_J100034).
| |
| − |
| |
| − | The primer sequences for individual promoters used for our synthetic biology project are as follows:
| |
| − |
| |
| − | groe-up CGCGGATCCCCAATACTGTTTTCTCAAATGGTATGTA BamHI
| |
| − |
| |
| − | groe-down CGGGGTACCTGAAATAACCTCCTCAATAGTATGA KpnI
| |
| − |
| |
| − | === Strains and Plasmids ===
| |
| − | <p>The bacterium strain we used was B. subtilis WB600, and the plasmid was WB0911H-ASN (with the antibiotic ampicillin and kanamycin resistance cassette). Both the strain and plasmid were kindly donated to us by Professor Jian CHEN at Jiannan University, China.</p>
| |
| − | [HERE SHOULD BE A FIGURE]
| |
| − |
| |
| − | <P>Figure 1. pMAA0911H-ASN transformation vector</P><br>
| |
| − | <P>The promoters Groe (BBa J100034), SecA (BBa K1469002), and P43 (BBa K208002) were used to replace the original promoter hpall in WB0911H-ASN respectively. Here ASN stands for L-asparaginase (EC.3.5.1.1). By the comparison of the ASN activity expressed in the transformants, we found that the p43 promoter was the strongest promoter. Therefore, it was selected for our project.</p><br>
| |
| − | The promoters Groe (BBa J100034), SecA (BBa K1469002), and P43 (BBa K208002) were used to replace the original promoter hpall in WB0911H-ASN respectively. Here ASN stands for L-asparaginase (EC.3.5.1.1). By the comparison of the ASN activity expressed in the transformants, we found that the p43 promoter was the strongest promoter. Therefore, it was selected for our project.
| |
| − |
| |
| − | === Experiment Method ===
| |
| − |
| |
| − |
| |
| − | #PCR amplification of ASN gene product
| |
| − | #Construction of transformation vectors (extraction of plasmids, digestion, conjugation and transformation, etc.)
| |
| − | #Construction of Bacillus subtilis transformants
| |
| − | #SDS-PAGE electrophoresis to confirm the ASN protein expression#The enzymatic activity of ASN was determined by colorimetric method. The detection process was divided into two steps: hydrolysis and coloration of ASN.
| |
| − | #The enzymatic activity of ASN was determined by colorimetric method. The detection process was divided into two steps: hydrolysis and coloration of ASN.
| |
| − | #*'''ASN hydrolysis''': 100 ml diluted solution with ASN was added to the 1100 ml mixture of substrate and buffer. The reaction lasted for 10 min at 37°C. It was terminated by adding 100 ml of trichloroacetic acid (1.5 M). The mixture was then centrifuged at 12000 rpm for 2 minutes. The final system consisted of 900μL KH2PO4-K2HPO4 buffer (20 mM, pH 7.5) and 200 μl L-asparagine (189 mM).
| |
| − | #*'''Coloration''': 100ml solution from ASN hydrolysis process was added to 3400μl deionized water, and 500μl Nessler's reagent was added for coloration, the absorbance value was detected at 436 nm. (Here the definition of ASN Enzyme Activity Unit is: The amount of enzymes required to hydrolyze L-asparagine to release 1μM NH3 in 1 minute at 37°C.<br>
| |
| − |
| |
| − | [HERE SHOULD BE A FIGURE]
| |
| − |
| |
| − | <P>Figure 2. Gel Electrophoresis</P><br>
| |
| − |
| |
| − | <p>ASN enzymatic activities with different transformants：</p>
| |
| − |
| |
| − | [HERE SHOULD BE A FIGURE]
| |
| − |
| |
| − | <p>Figure 3. ANS enzymatic activity vs strain</p><br>
| |
| − |
| |
| − | === Conclusion ===
| |
| − | <p>SDS-PAGE electrophoresis (Figure 2) and the ASN enzymatic activity comparison (Figure 3) show that the ASN production may be enhanced by the replacement of promoters. and among the promoters we have characterized, P43 has the highest start-up strength (the higher the enzyme activity, the thicker and brighter the corresponding band.</p><br>
| |
| − | <p>We have thus characterized the basic biobricks Groe (BBa J100034), SecA (BBa K1469002) and P43 (BBa K208002)</p>
| |
| − |
| |
| − | <p>SDS-PAGE electrophoresis results: (band for the ASN protein at 43kDa is highlighted in red color)
| |
| − | Column M is the marker, column 1, 2, 3, 4, 5 and 6 are for the Bacillus subtilis constructs with the plasmids of WB0911H-ASN(original plasmid)、WBGroE、WBYxiE、WBSecA、WBYlbP and WB43, respectively.</p>
| |
| | | | |
| | <!-- Uncomment this to enable Functional Parameter display | | <!-- Uncomment this to enable Functional Parameter display |
The default state of this promoter is off and can be induced by heat. It is 44 base pairs long and is located 72 bases upstream of the start site of groE. The groE gene is from E. coli.
