Difference between revisions of "Part:BBa K3190109:Design"
Line 9: | Line 9: | ||
The coding sequence for the receptor XLHCGR was codon optimised and fused with the nucleotides for the linker and superfolded GFP in the C-terminus (XLHCGR-Li-sfGFP) and coupled to the strongest constitutive promoter pCCW12 for heterologous expression in S. cerevisiae. The construct was important to carry out colocalisation assay and characterise the expression and proper alignment of the receptor in the intercellular organelles. | The coding sequence for the receptor XLHCGR was codon optimised and fused with the nucleotides for the linker and superfolded GFP in the C-terminus (XLHCGR-Li-sfGFP) and coupled to the strongest constitutive promoter pCCW12 for heterologous expression in S. cerevisiae. The construct was important to carry out colocalisation assay and characterise the expression and proper alignment of the receptor in the intercellular organelles. | ||
+ | The linker was added in the primer design. | ||
+ | Linker sequence: GGAGGTGGCTCTGGTGGTGGATCA | ||
Revision as of 21:44, 14 October 2019
Xenopus laevis lutropin-choriogonadotropic hormone receptor LHCGR CDS with Linker-superfolder GF
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 428
Illegal BglII site found at 1682 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 2179
Design Notes
The coding sequence for the receptor XLHCGR was codon optimised and fused with the nucleotides for the linker and superfolded GFP in the C-terminus (XLHCGR-Li-sfGFP) and coupled to the strongest constitutive promoter pCCW12 for heterologous expression in S. cerevisiae. The construct was important to carry out colocalisation assay and characterise the expression and proper alignment of the receptor in the intercellular organelles.
The linker was added in the primer design.
Linker sequence: GGAGGTGGCTCTGGTGGTGGATCA
Source
Xenopus laevis