Difference between revisions of "Ribosome Binding Sites/Prokaryotic/Constitutive/Community Collection"
Line 3: | Line 3: | ||
The Community RBS parts are suitable for general protein expression in ''E. coli'' or other prokaryotes. The family is known to cover a range of translation initiation rates so by testing a few family members it should be possible to find a translation initiation rate that suits your application. This collection of RBS parts has developed from the work of several members of the Synthetic Biology community (see Contributors below). The origin of individual RBS sequences can be found on the corresponding part pages. Individual family members have been characterized relative to each other or have been derived from other collection members. | The Community RBS parts are suitable for general protein expression in ''E. coli'' or other prokaryotes. The family is known to cover a range of translation initiation rates so by testing a few family members it should be possible to find a translation initiation rate that suits your application. This collection of RBS parts has developed from the work of several members of the Synthetic Biology community (see Contributors below). The origin of individual RBS sequences can be found on the corresponding part pages. Individual family members have been characterized relative to each other or have been derived from other collection members. | ||
− | ==Obtaining | + | ==Obtaining the Collection== |
Sequences for the Community Collection can be found in the table below. To obtain the physical DNA, we recommend two approaches - <br> | Sequences for the Community Collection can be found in the table below. To obtain the physical DNA, we recommend two approaches - <br> | ||
'''Via ''de novo'' synthesis''': Since the RBS parts are short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligos and annealed. See [[Ribosome Binding Sites/Construction|here]] for a tutorial on how to construct short parts via oligo annealing. | '''Via ''de novo'' synthesis''': Since the RBS parts are short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligos and annealed. See [[Ribosome Binding Sites/Construction|here]] for a tutorial on how to construct short parts via oligo annealing. | ||
Line 10: | Line 10: | ||
<br style="clear:both" /> | <br style="clear:both" /> | ||
− | ==Characterization | + | ==Characterization== |
The data quoted in the table below was obtained by Jason Kelly and Robbie Bryant during the summer of 2004 using a fluorescent reporter. Further data (although less quantitative) can be found in the doctoral thesis of [http://www.princeton.edu/~rweiss/papers/rweiss-phd-thesis.pdf Ron Weiss] (p79-80) and the supplementary methods of Gardner et al<cite>Gardner</cite>. Note that the rank order of strengths as measured by Weiss and Kelly & Bryant differ from those reported by Gardner et al. This discrepancy is likely due to differences in nucleotide sequence between the Ribosome Binding Site and the start codon due to the cloning strategies used by the different groups. As is typical for RBS, translation initiation rate can be highly dependent on upstream and downstream sequence for reasons such as RBS occlusion due to mRNA secondary structure or changes in mRNA stability. For this reason, the strengths of the RBS should be remeasured in different sequence contexts. Please contribute any data on this RBS family back to the registry. | The data quoted in the table below was obtained by Jason Kelly and Robbie Bryant during the summer of 2004 using a fluorescent reporter. Further data (although less quantitative) can be found in the doctoral thesis of [http://www.princeton.edu/~rweiss/papers/rweiss-phd-thesis.pdf Ron Weiss] (p79-80) and the supplementary methods of Gardner et al<cite>Gardner</cite>. Note that the rank order of strengths as measured by Weiss and Kelly & Bryant differ from those reported by Gardner et al. This discrepancy is likely due to differences in nucleotide sequence between the Ribosome Binding Site and the start codon due to the cloning strategies used by the different groups. As is typical for RBS, translation initiation rate can be highly dependent on upstream and downstream sequence for reasons such as RBS occlusion due to mRNA secondary structure or changes in mRNA stability. For this reason, the strengths of the RBS should be remeasured in different sequence contexts. Please contribute any data on this RBS family back to the registry. | ||
Revision as of 03:49, 8 September 2008
Description
The Community RBS parts are suitable for general protein expression in E. coli or other prokaryotes. The family is known to cover a range of translation initiation rates so by testing a few family members it should be possible to find a translation initiation rate that suits your application. This collection of RBS parts has developed from the work of several members of the Synthetic Biology community (see Contributors below). The origin of individual RBS sequences can be found on the corresponding part pages. Individual family members have been characterized relative to each other or have been derived from other collection members.
Obtaining the Collection
Sequences for the Community Collection can be found in the table below. To obtain the physical DNA, we recommend two approaches -
Via de novo synthesis: Since the RBS parts are short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligos and annealed. See here for a tutorial on how to construct short parts via oligo annealing.
Via the Registry distribution: Many of the RBS parts are included in the Registry DNA distribution.
Characterization
The data quoted in the table below was obtained by Jason Kelly and Robbie Bryant during the summer of 2004 using a fluorescent reporter. Further data (although less quantitative) can be found in the doctoral thesis of [http://www.princeton.edu/~rweiss/papers/rweiss-phd-thesis.pdf Ron Weiss] (p79-80) and the supplementary methods of Gardner et alGardner. Note that the rank order of strengths as measured by Weiss and Kelly & Bryant differ from those reported by Gardner et al. This discrepancy is likely due to differences in nucleotide sequence between the Ribosome Binding Site and the start codon due to the cloning strategies used by the different groups. As is typical for RBS, translation initiation rate can be highly dependent on upstream and downstream sequence for reasons such as RBS occlusion due to mRNA secondary structure or changes in mRNA stability. For this reason, the strengths of the RBS should be remeasured in different sequence contexts. Please contribute any data on this RBS family back to the registry.
Identifier | Sequencea | Strengthb |
---|---|---|
BBa_B0030 | TCTAGAGATTAAAGAGGAGAAATACTAGATG | 1 |
BBa_B0031 | TCTAGAGTCACACAGGAAACCTACTAGATG | 0.12 |
BBa_B0032 | TCTAGAGTCACACAGGAAAGTACTAGATG | 0.5 |
BBa_B0033 | TCTAGAGTCACACAGGACTACTAGATG | 0.012 |
aThe sequence of individual RBS are shown in black and red. The grey nucleotides show the bracketing sequence that results from assembling the RBS with an upstream part and a downstream coding sequence. The start codon of the downstream coding sequence is shown in green. See the "Obtaining Anderson RBS parts" section above for a description of how the physical DNA sequence of the Anderson RBS parts in the Registry differs slightly from the BioBrick® standard.
aThe relative strengths of these RBS were measured by Jason Kelly and Robbie Bryant during the summer of 2004 using a fluorescent reporter.
References
The remaining members of the set were first described by Gardner et alGardner. Further information about the RBS parts can be obtained from Prof. Weiss' [http://www.princeton.edu/~rweiss/papers/rweiss-phd-thesis.pdf PhD thesis]. <biblio>
- Gardner pmid=10659857
</biblio>
Contributors