Difference between revisions of "Part:BBa K3142000:Design"
(No difference)
|
Revision as of 23:48, 28 September 2019
Acid-induced promoter(PrcfB)
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal prefix found in sequence at 9
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 9
Illegal NotI site found at 15 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 9
- 23INCOMPATIBLE WITH RFC[23]Illegal prefix found in sequence at 9
- 25INCOMPATIBLE WITH RFC[25]Illegal prefix found in sequence at 9
Illegal XbaI site found at 24 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
atgaaaaaaaagattatctcagctattttaatgtctacagtgatactttctgctgctgccccgttgtcaggtgtttacgctgacacaaactcagatattgctaaacaagatgcg
Source
Source:Lactococcus lactis MG1363