Difference between revisions of "Part:BBa K2524000"

 
(21 intermediate revisions by 4 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K2524000 short</partinfo>
 
<partinfo>BBa_K2524000 short</partinfo>
 
This part is an improvement of [[Part:BBa_K732001]].
 
This part is an improvement of [[Part:BBa_K732001]].
Human Chorionic Gonadotropin (hCG)  is the hormone made by chorionic cells in the fetal part of the placenta where it stimulates the ovaries to synthesize important steroids for the maintenance of pregnancy. It is a member of the beta chain glycoprotein hormone family. The glycoproteins are heterodimers consisting of an alpha subunit and beta subunit. The beta subunit determines bio-specificity. Six genes encode the hCG beta subunit which are inverted on chromosome 19q13.3 and is boarding the luteinizing hormone beta subunit gene.
+
Human Chorionic Gonadotropin (hCG)  is the hormone made by chorionic cells in the fetal part of the placenta where it stimulates the ovaries to synthesize important steroids for the maintenance of pregnancy. It is a member of the beta chain glycoprotein hormone family. The glycoproteins are heterodimers consisting of an alpha subunit and beta subunit. The beta subunit determines bio-specificity. Six genes encode the hCG beta subunit which are inverted on chromosome 19q13.3 and is boarding the luteinizing hormone beta subunit gene.  
 +
 
 +
<p>The presence of hCG is detectable by immunologic means within days of fertilization and forms the foundation of the common pregnancy tests. The hCG Beta-subunit has the epitopes that are detected by pregnancy tests, when hCG is present a pregnancy test will produce a positive result. It can be used in scenarios when detecting the autocatalysis of an enzyme. When hCG is fused to the end of an enzyme that is immobilized in a solution, if autocatalysis took place the hCG will be released into the solution and produce a positive pregnancy test result.</p>
  
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
The presence of hCG is detectable by immunologic means within days of fertilization and forms the foundation of the common pregnancy tests. The hCG Beta-subunit has the epitopes that are detected by pregnancy tests, when hCG is present a pregnancy test will produce a positive result. It can be used in scenarios when detecting the autocatalysis of an enzyme. When hCG is fused to the end of an enzyme that is immobilized in a solution, if autocatalysis took place the hCG will be released into the solution and produce a positive pregnancy test result.
 
  
 
<img src="https://static.igem.org/mediawiki/2017/d/d9/T--Georgia_State--hcgbetasubunit.jpg"  alt="HCGstructure" width="250" height="250" style="float:right;">
 
  
 
<!-- -->
 
<!-- -->
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K2524000 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K2524000 SequenceAndFeatures</partinfo>
 +
<table>
 +
<tr><td width="75%">
 +
<table><tr>
 +
<td width="50%" align=center><p align=left><b>A</b><br></p>
 +
https://parts.igem.org/File:T--Georgia_State--hcgbetasubunit.jpg
 +
 +
</tr>
 +
</table>
 +
 +
Optimized primers for HCG for pSB1C3 <br>
 +
Name: HCG New Prefix Primer 1 <br>
 +
Sequence: agtcgaattcgcggccgcttctagATGGAAATGTTCCAGGGGCT <br>
 +
Annealing Temperature: 56℃ <br>
 +
Name: New HCG Suffix <br>
 +
Sequence: GCAACTGCAGCGGCCGCTACTAGTATCACTGAGGAAGAATTGGGGTG <br>
 +
Annealing Temperature: 64℃ <br>
 +
<br>
 +
Optimized primer for HCG for pGEX <br>
 +
Name: new hcg reverse for pGEX <br>
 +
Sequence: CGACGTACGGTCgcggccgcTCACTGAGGAAGAATTGGGGTG <br>
 +
Annealing Temperature: 70℃ <br>
 +
Name: HCG for pGEX F <br>
 +
Sequence: cccaatttagaattcgATGGAAATGTTCCAGGGGCT <br>
 +
Annealing Temperature: 62℃ <br>
 +
 +
https://static.igem.org/mediawiki/2018/1/14/T--Georgia_State--Beta_subunit_in_pSB1C3_Sequencing.jpeg
 +
 +
<p>Figure 1.3 Recombinant HCG Beta Subunit was successfully ligated into the pSB1C3 vector and was verified by sequencing several samples.  </p>
 +
 +
<p>Figure 1.4 Recombinant HCG Beta Subunit was successfully ligated into the pGEX vector and was verified by sequencing several samples. The pGEX vector will be used for protein expression in Rosetta Gami cells.</p>
 +
https://static.igem.org/mediawiki/2018/d/d9/T--Georgia_State--recombinant_hCG_Beta_Subunit_Sequencing.jpeg
 +
https://static.igem.org/mediawiki/2018/6/63/T--Georgia_State--gel.jpeg
 +
<p>Figure 1.5 Expressed and isolated hCG Beta subunit protein tagged with the GST
 +
Key<br>
 +
Lane 1: Elution 1<br>
 +
Lane 2: Elution 2<br>
 +
Lane 3: Pellet <br>
 +
Lane 4: Supernatant<br>
 +
Lane 5: Elution 1 <br>
 +
Lane 6: Elution 2<br>
 +
Lane 7: Pellet  <br>
 +
Lane 8: Supernatant <br>
 +
Lane 9: Super signal <br>
 +
Lane 10: SDS Page Standard Low Range<br>
 +
 +
The higher bands at around 40-50 kDa are the targeted hCG-GST fusion protein. However this fusion protein was not detected by hCG antibodies, so the GST was cleaved and another Western Blot using hCG antibodies was done. </p>
 +
https://static.igem.org/mediawiki/2018/9/9a/T--Georgia_State--western_blot_and_coomassie.jpeg
 +
<p>We found that our synthetically produced recombinant hCG beta subunit was detected by the hCG antibodies used to probe our nitrocellulose paper. Theoretically, the produced protein should also trigger a positive response on a pregnancy test strip, but it did not. This could be due to the fact that our concentrations are too low and other material present in the elutions could be blocking the binding of the antibodies.</p>
 +
  
  

Latest revision as of 03:58, 18 October 2018


Synthetic Human Chorionic Gonadotropin (HCG) Beta Subunit This part is an improvement of Part:BBa_K732001. Human Chorionic Gonadotropin (hCG) is the hormone made by chorionic cells in the fetal part of the placenta where it stimulates the ovaries to synthesize important steroids for the maintenance of pregnancy. It is a member of the beta chain glycoprotein hormone family. The glycoproteins are heterodimers consisting of an alpha subunit and beta subunit. The beta subunit determines bio-specificity. Six genes encode the hCG beta subunit which are inverted on chromosome 19q13.3 and is boarding the luteinizing hormone beta subunit gene.

The presence of hCG is detectable by immunologic means within days of fertilization and forms the foundation of the common pregnancy tests. The hCG Beta-subunit has the epitopes that are detected by pregnancy tests, when hCG is present a pregnancy test will produce a positive result. It can be used in scenarios when detecting the autocatalysis of an enzyme. When hCG is fused to the end of an enzyme that is immobilized in a solution, if autocatalysis took place the hCG will be released into the solution and produce a positive pregnancy test result.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

A

https://parts.igem.org/File:T--Georgia_State--hcgbetasubunit.jpg

Optimized primers for HCG for pSB1C3
Name: HCG New Prefix Primer 1
Sequence: agtcgaattcgcggccgcttctagATGGAAATGTTCCAGGGGCT
Annealing Temperature: 56℃
Name: New HCG Suffix
Sequence: GCAACTGCAGCGGCCGCTACTAGTATCACTGAGGAAGAATTGGGGTG
Annealing Temperature: 64℃

Optimized primer for HCG for pGEX
Name: new hcg reverse for pGEX
Sequence: CGACGTACGGTCgcggccgcTCACTGAGGAAGAATTGGGGTG
Annealing Temperature: 70℃
Name: HCG for pGEX F
Sequence: cccaatttagaattcgATGGAAATGTTCCAGGGGCT
Annealing Temperature: 62℃

T--Georgia_State--Beta_subunit_in_pSB1C3_Sequencing.jpeg

Figure 1.3 Recombinant HCG Beta Subunit was successfully ligated into the pSB1C3 vector and was verified by sequencing several samples.

Figure 1.4 Recombinant HCG Beta Subunit was successfully ligated into the pGEX vector and was verified by sequencing several samples. The pGEX vector will be used for protein expression in Rosetta Gami cells.

T--Georgia_State--recombinant_hCG_Beta_Subunit_Sequencing.jpeg T--Georgia_State--gel.jpeg

Figure 1.5 Expressed and isolated hCG Beta subunit protein tagged with the GST Key
Lane 1: Elution 1
Lane 2: Elution 2
Lane 3: Pellet
Lane 4: Supernatant
Lane 5: Elution 1
Lane 6: Elution 2
Lane 7: Pellet
Lane 8: Supernatant
Lane 9: Super signal
Lane 10: SDS Page Standard Low Range
The higher bands at around 40-50 kDa are the targeted hCG-GST fusion protein. However this fusion protein was not detected by hCG antibodies, so the GST was cleaved and another Western Blot using hCG antibodies was done.

T--Georgia_State--western_blot_and_coomassie.jpeg

We found that our synthetically produced recombinant hCG beta subunit was detected by the hCG antibodies used to probe our nitrocellulose paper. Theoretically, the produced protein should also trigger a positive response on a pregnancy test strip, but it did not. This could be due to the fact that our concentrations are too low and other material present in the elutions could be blocking the binding of the antibodies.