Difference between revisions of "Part:BBa K2640001"

 
(4 intermediate revisions by one other user not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K2640001 short</partinfo>
 
<partinfo>BBa_K2640001 short</partinfo>
  
The BBa_K2640001 part is the coding sequence of Recombinant HCG Beta subunit Beta 3 loop epitope. The β3-loop of hCGβ66–80 ,also known as hCG Beta 3 Loop is an epitope present on the beta subunit of the hormone hCG. Human Chorionic Gonadotropin (hCG) is the hormone made by chorionic cells in the fetal part of the placenta where it stimulates the ovaries to synthesize important steroids for the maintenance of pregnancy. It is a member of the beta chain glycoprotein hormone family. The glycoproteins are heterodimers consisting of an alpha subunit and beta subunit. The beta subunit determines bio-specificity. There are numerous epitopes present on the beta subunit of hCG which are detected by hCG antibodies including those present in pregnancy test strips. According to the Journal of Biology Chemistry, “...The performance of a single site assay depends on the identity and nature of the chosen epitope, and it is crucial that it is present, intact and correctly folded in every hCG variant encountered. It is against this background that the β3-loop of hCGβ66–80 has been identified as a potentially ideal epitope…” (Gregor et al, 2011).
+
The BBa_K2640001 part is the coding sequence of Recombinant HCG Beta subunit Beta 3 loop epitope. The β3-loop of hCGβ66–80 ,also known as hCG Beta 3 Loop is an epitope present on the beta subunit of the hormone hCG. Human Chorionic Gonadotropin (hCG) is the hormone made by chorionic cells in the fetal part of the placenta where it stimulates the ovaries to synthesize important steroids for the maintenance of pregnancy. It is a member of the beta chain glycoprotein hormone family. The glycoproteins are heterodimers consisting of an alpha subunit and beta subunit. The beta subunit determines bio-specificity. There are numerous epitopes present on the beta subunit of hCG which are detected by hCG antibodies including those present in pregnancy test strips. According to the Journal of Biology Chemistry, “...The performance of a single site assay depends on the identity and nature of the chosen epitope, and it is crucial that it is present, intact and correctly folded in every hCG variant encountered. It is against this background that the β3-loop of hCGβ66–80 has been identified as a potentially ideal epitope…” (Gregor et al, 2011).<br>
 +
 
 +
https://static.igem.org/mediawiki/2018/c/c7/T--Georgia_State--Beta_3_Loop_protein_image.JPG
 +
 
 
<table>
 
<table>
 
<tr>Optimized primers for hCG Beta 3 Loop</tr>
 
<tr>Optimized primers for hCG Beta 3 Loop</tr>
Line 21: Line 23:
 
Annealing Temperature:  79℃ <br>  
 
Annealing Temperature:  79℃ <br>  
  
 
+
https://static.igem.org/mediawiki/2018/b/b7/T--Georgia_State--Beta_3_loop_into_pGEx_sequencing.jpeg <br>
 
The hCG Beta 3 Loop coding sequence in pGEX was verified by sequencing   
 
The hCG Beta 3 Loop coding sequence in pGEX was verified by sequencing   
  
 
Expressing the Beta 3 Loop tagged with GST using IPTG for promotion  
 
Expressing the Beta 3 Loop tagged with GST using IPTG for promotion  
  
 +
https://static.igem.org/mediawiki/2018/9/9a/T--Georgia_State--western_blot_and_coomassie.jpeg  <br>
 +
The Western Blot using anti-hCG (Figure 1.5) contains protein elutions of the Beta 3 Loop-GST fusion protein in lanes 3 and 4. Lane 13 shows the hCG protein standard. There was no detection by the hCG antibodies, however the Coomassie Blue stain shows the presence of poorly lysed cells. Lane 6 contains the cell debris from the protein isolation experiments and there is a very heavy band at the exact located the Beta 3 Loop and the GST fusion protein are expected to be, around 22-28 kDa. Our cell lysis step was not optimal, causing a large, aggregated protein mass in the cell debris (lane 6). The other samples present on the Coomassie Blue stain and the blot are of Part BBa_2524000, which was used to create this part.</p>
 +
 +
<p>Citations</p>
 +
<p>Gregor, C. R., Cerasoli, E., Schouten, J., Ravi, J., Slootstra, J., Horgan, A., . . . Crain, J. (2011). Antibody Recognition of a Human Chorionic Gonadotropin Epitope (hCGβ66–80) Depends on Local Structure Retained in the Free Peptide. Journal of Biological Chemistry, 286(28), 25016-25026. doi:10.1074/jbc.m111.246637</p>
  
The Western Blot using anti-hCG (Figure 1.5) contains protein elutions of the Beta 3 Loop-GST fusion protein in lanes 3 and 4. Lane 13 shows the hCG protein standard. There was no detection by the hCG antibodies, however the Coomassie Blue stain shows the presence of poorly lysed cells. Lane 6 contains the cell debris from the protein isolation experiments and there is a very heavy band at the exact located the Beta 3 Loop and the GST fusion protein are expected to be, around 22-28 kDa. Our cell lysis step was not optimal, causing a large, aggregated protein mass in the cell debris (lane 6). The other samples present on the Coomassie Blue stain and the blot are of Part BBa_2524000, which was used to create this part.
 
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
Line 36: Line 42:
 
<partinfo>BBa_K2640001 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K2640001 SequenceAndFeatures</partinfo>
  
https://static.igem.org/mediawiki/2018/c/c7/T--Georgia_State--Beta_3_Loop_protein_image.JPG
+
 
<br>
+
Optimized primers for hCG Beta 3 Loop <br>
+
Name: Beta 3 Loop with biobrick prefix <br>
+
Sequence: AAGGAGAATTCGCGGCCGCTTCTAGTCCATTCGTTTACCCGGATG <br>
+
Annealing Temperature: 56℃ <br>
+
Name: Beta 3 Loop Biobrick Suffix  <br>
+
Sequence: AAGGCTGCAGCGGCCGCTACTAGTACACGACTGGGTTTACTCCG <br>
+
Annealing Temperature:  64℃ <br>
+
<br>
+
Optimized primer for hCG Beta 3 Loop <br>
+
Name:Beta 3 Loop primer for pGEX F <br>
+
Sequence: ttcgcccaatttagaattcgAGTCCATTCGTTTACCCGGA v
+
Annealing Temperature:  68℃ <br>
+
Name: Beta 3 Loop primer for GEX R <br>
+
Sequence: AGCTCGACGTACGGTCGCGGCCGCACACGACTGGGTTTACTCCGCG <br>
+
Annealing Temperature:  79℃ <br>
+
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>BBa_K2640001 parameters</partinfo>
 
<partinfo>BBa_K2640001 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Latest revision as of 03:35, 18 October 2018

Recombinant hCG Beta Subunit Beta 3 Loop

The BBa_K2640001 part is the coding sequence of Recombinant HCG Beta subunit Beta 3 loop epitope. The β3-loop of hCGβ66–80 ,also known as hCG Beta 3 Loop is an epitope present on the beta subunit of the hormone hCG. Human Chorionic Gonadotropin (hCG) is the hormone made by chorionic cells in the fetal part of the placenta where it stimulates the ovaries to synthesize important steroids for the maintenance of pregnancy. It is a member of the beta chain glycoprotein hormone family. The glycoproteins are heterodimers consisting of an alpha subunit and beta subunit. The beta subunit determines bio-specificity. There are numerous epitopes present on the beta subunit of hCG which are detected by hCG antibodies including those present in pregnancy test strips. According to the Journal of Biology Chemistry, “...The performance of a single site assay depends on the identity and nature of the chosen epitope, and it is crucial that it is present, intact and correctly folded in every hCG variant encountered. It is against this background that the β3-loop of hCGβ66–80 has been identified as a potentially ideal epitope…” (Gregor et al, 2011).

T--Georgia_State--Beta_3_Loop_protein_image.JPG

Optimized primers for hCG Beta 3 LoopName: Beta 3 Loop with biobrick prefixSequence: AAGGAGAATTCGCGGCCGCTTCTAGTCCATTCGTTTACCCGGATG Annealing Temperature: 56℃
Name: Beta 3 Loop Biobrick Suffix
Sequence: AAGGCTGCAGCGGCCGCTACTAGTACACGACTGGGTTTACTCCG
Annealing Temperature: 64℃
Optimized primer for hCG Beta 3 Loop
Name:Beta 3 Loop primer for pGEX F
Sequence: ttcgcccaatttagaattcgAGTCCATTCGTTTACCCGGA v Annealing Temperature: 68℃
Name: Beta 3 Loop primer for pGEX R
Sequence: AGCTCGACGTACGGTCGCGGCCGCACACGACTGGGTTTACTCCGCG
Annealing Temperature: 79℃
T--Georgia_State--Beta_3_loop_into_pGEx_sequencing.jpeg
The hCG Beta 3 Loop coding sequence in pGEX was verified by sequencing Expressing the Beta 3 Loop tagged with GST using IPTG for promotion T--Georgia_State--western_blot_and_coomassie.jpeg
The Western Blot using anti-hCG (Figure 1.5) contains protein elutions of the Beta 3 Loop-GST fusion protein in lanes 3 and 4. Lane 13 shows the hCG protein standard. There was no detection by the hCG antibodies, however the Coomassie Blue stain shows the presence of poorly lysed cells. Lane 6 contains the cell debris from the protein isolation experiments and there is a very heavy band at the exact located the Beta 3 Loop and the GST fusion protein are expected to be, around 22-28 kDa. Our cell lysis step was not optimal, causing a large, aggregated protein mass in the cell debris (lane 6). The other samples present on the Coomassie Blue stain and the blot are of Part BBa_2524000, which was used to create this part.</p>

Citations

Gregor, C. R., Cerasoli, E., Schouten, J., Ravi, J., Slootstra, J., Horgan, A., . . . Crain, J. (2011). Antibody Recognition of a Human Chorionic Gonadotropin Epitope (hCGβ66–80) Depends on Local Structure Retained in the Free Peptide. Journal of Biological Chemistry, 286(28), 25016-25026. doi:10.1074/jbc.m111.246637


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]