Difference between revisions of "Part:BBa K2640001"
Line 4: | Line 4: | ||
The BBa_K2640001 part is the coding sequence of Recombinant HCG Beta subunit Beta 3 loop epitope. The β3-loop of hCGβ66–80 ,also known as hCG Beta 3 Loop is an epitope present on the beta subunit of the hormone hCG. Human Chorionic Gonadotropin (hCG) is the hormone made by chorionic cells in the fetal part of the placenta where it stimulates the ovaries to synthesize important steroids for the maintenance of pregnancy. It is a member of the beta chain glycoprotein hormone family. The glycoproteins are heterodimers consisting of an alpha subunit and beta subunit. The beta subunit determines bio-specificity. There are numerous epitopes present on the beta subunit of hCG which are detected by hCG antibodies including those present in pregnancy test strips. According to the Journal of Biology Chemistry, “...The performance of a single site assay depends on the identity and nature of the chosen epitope, and it is crucial that it is present, intact and correctly folded in every hCG variant encountered. It is against this background that the β3-loop of hCGβ66–80 has been identified as a potentially ideal epitope…” (Gregor et al, 2011). | The BBa_K2640001 part is the coding sequence of Recombinant HCG Beta subunit Beta 3 loop epitope. The β3-loop of hCGβ66–80 ,also known as hCG Beta 3 Loop is an epitope present on the beta subunit of the hormone hCG. Human Chorionic Gonadotropin (hCG) is the hormone made by chorionic cells in the fetal part of the placenta where it stimulates the ovaries to synthesize important steroids for the maintenance of pregnancy. It is a member of the beta chain glycoprotein hormone family. The glycoproteins are heterodimers consisting of an alpha subunit and beta subunit. The beta subunit determines bio-specificity. There are numerous epitopes present on the beta subunit of hCG which are detected by hCG antibodies including those present in pregnancy test strips. According to the Journal of Biology Chemistry, “...The performance of a single site assay depends on the identity and nature of the chosen epitope, and it is crucial that it is present, intact and correctly folded in every hCG variant encountered. It is against this background that the β3-loop of hCGβ66–80 has been identified as a potentially ideal epitope…” (Gregor et al, 2011). | ||
− | + | <table> | |
− | + | <tr>Optimized primers for hCG Beta 3 Loop</tr> | |
− | Optimized primers for hCG Beta 3 Loop < | + | <tr>Name: Beta 3 Loop with biobrick prefix</tr> |
− | Name: Beta 3 Loop with biobrick prefix < | + | <tr>Sequence: AAGGAGAATTCGCGGCCGCTTCTAGTCCATTCGTTTACCCGGATG</tr> |
− | Sequence: AAGGAGAATTCGCGGCCGCTTCTAGTCCATTCGTTTACCCGGATG < | + | |
Annealing Temperature: 56℃ <br> | Annealing Temperature: 56℃ <br> | ||
Name: Beta 3 Loop Biobrick Suffix <br> | Name: Beta 3 Loop Biobrick Suffix <br> | ||
Sequence: AAGGCTGCAGCGGCCGCTACTAGTACACGACTGGGTTTACTCCG <br> | Sequence: AAGGCTGCAGCGGCCGCTACTAGTACACGACTGGGTTTACTCCG <br> | ||
Annealing Temperature: 64℃ <br> | Annealing Temperature: 64℃ <br> | ||
+ | |||
Optimized primer for hCG Beta 3 Loop <br> | Optimized primer for hCG Beta 3 Loop <br> | ||
Name:Beta 3 Loop primer for pGEX F <br> | Name:Beta 3 Loop primer for pGEX F <br> | ||
Sequence: ttcgcccaatttagaattcgAGTCCATTCGTTTACCCGGA v | Sequence: ttcgcccaatttagaattcgAGTCCATTCGTTTACCCGGA v | ||
Annealing Temperature: 68℃ <br> | Annealing Temperature: 68℃ <br> | ||
− | Name: Beta 3 Loop primer for | + | Name: Beta 3 Loop primer for pGEX R <br> |
Sequence: AGCTCGACGTACGGTCGCGGCCGCACACGACTGGGTTTACTCCGCG <br> | Sequence: AGCTCGACGTACGGTCGCGGCCGCACACGACTGGGTTTACTCCGCG <br> | ||
Annealing Temperature: 79℃ <br> | Annealing Temperature: 79℃ <br> |
Revision as of 03:02, 18 October 2018
Recombinant hCG Beta Subunit Beta 3 Loop
The BBa_K2640001 part is the coding sequence of Recombinant HCG Beta subunit Beta 3 loop epitope. The β3-loop of hCGβ66–80 ,also known as hCG Beta 3 Loop is an epitope present on the beta subunit of the hormone hCG. Human Chorionic Gonadotropin (hCG) is the hormone made by chorionic cells in the fetal part of the placenta where it stimulates the ovaries to synthesize important steroids for the maintenance of pregnancy. It is a member of the beta chain glycoprotein hormone family. The glycoproteins are heterodimers consisting of an alpha subunit and beta subunit. The beta subunit determines bio-specificity. There are numerous epitopes present on the beta subunit of hCG which are detected by hCG antibodies including those present in pregnancy test strips. According to the Journal of Biology Chemistry, “...The performance of a single site assay depends on the identity and nature of the chosen epitope, and it is crucial that it is present, intact and correctly folded in every hCG variant encountered. It is against this background that the β3-loop of hCGβ66–80 has been identified as a potentially ideal epitope…” (Gregor et al, 2011).