Difference between revisions of "Part:BBa K2834003"

Revision as of 18:43, 17 October 2018

Expressible apidaecin antimicrobial peptide from Apis mellifera

This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, apidaecin, a 6x His-Tag, and a T1 terminator from E. coli. This composite enables the expression of apidaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.

As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 2 and the His-tag. The exact synthesized sequence is:
CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTC

Usage and Biology

In the last few years, a lot of effort has been concentrated in the search of new alternative treatments against infections. Apidaecins are antimicrobial peptides isolated from lymph fluid of the adult honeybee that have come to address this necessity². Structurally, these peptides are composed of 18 residues, containing 6 prolines (33%). This composition provides Apidaecin with a helical structure, antibacterial capacity, and high stability at acidic conditions. These properties have made Apidaecin a potential novel antibiotic drug¹.

The mechanism of action of Apidaecin starts with the binding of the peptides to the outer membrane of bacteria. This binding is followed by the invasion of the periplasmic space, and by an irreversible combination with a receptor/docking molecule, component of a permease-type transporter system on inner membrane drug³. In our project, this mechanism of action suggested the use of Apidaecin as an alternative treatment against two diseases that affect Honeybee larvae, the American and European foulbrood.

Characterization of apidaecin atimicrobial peptide

This composite will be characterized with the intention of expressing abaecin in E. coli BL21 (DE3) by IPTG induction. Subsequently, its antimicrobial activity will be evaluated against Gram-positive bacteria with antibiotimicrobial susceptibility testing by measuring OD₆₀₀ in broth.

BioBrick™ assembly

To achieve this goal, firstly, the composite was synthesized by IDT® with the prefix and suffix flanking the region of interest. The final part resulted in a sequence of 310 base pairs. Once the synthesis arrived, double digestion with EcoRI-HF and PstI restriction enzymes was made to the composite, and the chloramphenicol linearized plasmid backbone (pSB1C3) for following ligation of both fragments. This resulted in a complete expression plasmid of 2337 base pairs. Afterward, Escherichia coli BL21(DE3) was transformed by heat shock for following the antibiotic selection of clones. Next step consisted of plasmid extraction and electrophoresis gel of the uncut plasmid, linearized plasmid with one enzyme, and linearized plasmid with two enzymes. This agarose gel allowed the confirmation of the correct plasmid construction.

_{Figure 1. (On the left) SnapGene® map of BBa__K2834003. (On the right) Agarose gel electrophoresis of BBa__K2834003 compared with NEB Quick-Load® Purple 1Kb Plus DNA Ladder, where the highlighted band corresponds to approximately 2337 bp.}

IPTG protein induction and extraction

Following the construction of the BioBrick, it was necessary to induce protein production. Since the T7 promoter regulates transcription of the construct, isopropyl β-D-1 thiogalactopyranoside (IPTG) is used as an inducer for T7 RNA polymerase production. The concentration of IPTG used was 0.5 mM. After induction, the cultures were incubated for six hours at 37 °C and 225 rpm. After that, protein extraction by lysis solution was made in order to obtain the soluble peptides. For insoluble peptides, the sample was treated with lysis solution+6M urea.

SDS-PAGE

After protein extraction, electrophoresis in a polyacrylamide gel (12%) was performed to corroborate the peptide of interest was indeed expressed. To calculate the molecular weight of the peptide, the Promega Biomath Calculator was used. The DNA length (bp) of the peptide was introduced, and Promega’s tool calculated the molecular weight in kDa. For apidaecin, a band at 2.75 kDa was expected.

Antibiotimicrobial susceptibility testing

In order to prove the antibacterial activity of apidaecin, antimicrobial susceptibility tests were performed for two different bacteria: Bacillus subtilis and Streptococcus pyogenes. B. subtilis was chosen because it is one of the best known Gram-positive microorganisms and S. pyogenes was chosen because it is one of the most important bacterial pathogens to humans. They both are widely known, commonly used, and thus allowed to better analyze the activity that the peptide has.

Being unable to isolate our peptides by affinity tag purification due to lack of equipment, crude protein extract was used in the experiment. In order to validate the experiment, different concentrations of the peptide and several controls were used; 15 ml of LB broth, with a bactericide agent or a control, were inoculated with 100μl of the overnight culture of each bacteria. Afterward, OD₆₀₀ was measured at 3, 6, 9, and 21 hours after inoculation.

Antibiotimicrobial susceptibility test results

B. subtilis (figure 2a) was treated with 28.52 μg/mL (LC) and 142.6 μg/mL (HC) of total proteins of transformed E. coli BL21 (DE3) with apidaecin. Also, it was treated with 29.565 μg/mL (LC) and 147.825 μg/mL (HC) of untransformed E. coli BL21 (DE3) for negative control. A culture of B. subtilis was used as a negative control as well. At 21 h, both concentrations of apidaecin produced a decrease in OD₆₀₀ compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with apidaecin OD_{600_{decreases in 15.15% and with the highest one it decreases in 15.75%.</p>

<p align="justify">S. pyogenes (figure 2b) was treated with the same concentrations as B. subtilis. At 21 h, both concentrations of apidaecin produced a decrease in OD₆₀₀ compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with apidaecin OD600 decreases in 10.2% and with the highest one it decreases in 12.45%.</p>}}

_{Figure 2. Antimicrobial susceptibility testing results for apidaecin. a)B. subtilis challenged with low (LC) and high (HC) concentrations of total proteins of transformed E. coli BL21 (DE3) with apidaecin and total proteins of untransformed E. coli BL21 (DE3). b) S. pyogenes challenged with low (LC) and high (HC) concentrations of total proteins of transformed E. coli BL21 (DE3) with apidaecin and total proteins of untransformed E. coli BL21 (DE3).}

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
INCOMPATIBLE WITH RFC[25]
Illegal NgoMIV site found at 86
1000
COMPATIBLE WITH RFC[1000]

References

1. Casteels, P., Ampe, C., Jacobs, F., Vaeck, M., & Tempst, P. (1989). Apidaecins: antibacterial peptides from honeybees. The EMBO Journal, 8(8), 2387–2391.
2. Mishra, A., Choi, J., Moon, E., & Baek, K.-H. (2018). Tryptophan-Rich and Proline-Rich Antimicrobial Peptides. Molecules, 23(4), 815. https://doi.org/10.3390/molecules23040815
3. Wei-Fenm L., Guo-Xia, M., & Xu-Xia, Z. (2006). Apidaecin-type peptides: Biodiversity, structure–function relationships and mode of action. National Institute for Biotechnology Information. DOI: 10.1016/j.peptides.2006.03.016
</p>

@@ Line 59: / Line 59: @@
 <div class="row">
 <div class="col-md-12">
-<center><sub>Figure 2. Antimicrobial susceptibility testing results for apidaecin. a)<i>B. subtilis</i> challenged with low (LC) and high (HC) concentrations of total proteins of transformed <i>E. coli</i> BL21 (DE3) with apidaecin and total proteins of untransformed <i>E. coli<i> BL21 (DE3). b) <i>S. pyogenes</i> challenged with low (LC) and high (HC) concentrations of total proteins of transformed <i>E. coli</i> BL21 (DE3) with apidaecin and total proteins of untransformed <i>E. coli</i> BL21 (DE3).
+<center><sub>Figure 2. Antimicrobial susceptibility testing results for apidaecin. a)<i>B. subtilis</i> challenged with low (LC) and high (HC) concentrations of total proteins of transformed <i>E. coli</i> BL21 (DE3) with apidaecin and total proteins of untransformed <i>E. coli</i> BL21 (DE3). b) <i>S. pyogenes</i> challenged with low (LC) and high (HC) concentrations of total proteins of transformed <i>E. coli</i> BL21 (DE3) with apidaecin and total proteins of untransformed <i>E. coli</i> BL21 (DE3).
 </sub></center>