Difference between revisions of "Part:BBa K2794003"

 
(4 intermediate revisions by the same user not shown)
Line 24: Line 24:
 
==Overview==
 
==Overview==
 
WW domain is a 40 amino acid length domain that can primarily bind to PPxY motif. It was first discovered on NEDD4 protein, enabling NEDD4 to bind with Ndfip, thus initiating ubquitination. Soon the interaction between WW domain and PPxY motif was found in many irrelevant signaling pathway including viral gag proteins, interleukin receptors and several serine/threonine kinases , indicating a universal significance. It’s worth to mention that WW domain on NEDD4 specifically can bind to an in vitro PY motif, which permits a more flexible way for experiments.  
 
WW domain is a 40 amino acid length domain that can primarily bind to PPxY motif. It was first discovered on NEDD4 protein, enabling NEDD4 to bind with Ndfip, thus initiating ubquitination. Soon the interaction between WW domain and PPxY motif was found in many irrelevant signaling pathway including viral gag proteins, interleukin receptors and several serine/threonine kinases , indicating a universal significance. It’s worth to mention that WW domain on NEDD4 specifically can bind to an in vitro PY motif, which permits a more flexible way for experiments.  
 +
 
[[File:T--SHSU_China--NEDD4.png|400px|]]
 
[[File:T--SHSU_China--NEDD4.png|400px|]]
  
 
'''Figure 1: NEDD4'''
 
'''Figure 1: NEDD4'''
 +
 
In experiments, in order to obtain the best binding efficiency with PPxY motif, Team SHSU_China chose the third and fourth from all 4 WW domains on NEDD4 to continue.
 
In experiments, in order to obtain the best binding efficiency with PPxY motif, Team SHSU_China chose the third and fourth from all 4 WW domains on NEDD4 to continue.
 
==Design==
 
==Design==
Line 35: Line 37:
  
 
'''WW3-Reverse:'''TGCACTGCAGGCTCTAGACGGAATTTTCAGACGCGGATCTT
 
'''WW3-Reverse:'''TGCACTGCAGGCTCTAGACGGAATTTTCAGACGCGGATCTT
 +
 
[[File:T--SHSU_China--plasmids.jpeg|600px|]]
 
[[File:T--SHSU_China--plasmids.jpeg|600px|]]
  
Line 41: Line 44:
 
==Prove of Expression==
 
==Prove of Expression==
  
Team SHSU_China used HEK 293T cells in their exosome experiments. After using sequencing to conform the sequence of Ndfip, 2ug of vecter is transfected to a 60mm plate using lipofectamine 2000. Exosomes are extracted from the 4ml culture media using total exosome isolation kit (from cell culture media) from Invitrogen. Cells and exosomes are lysed using Ripa.
+
Team SHSU_China used HEK 293T cells in their exosome experiments. After using sequencing to conform the sequence, 2ug of vector (or 2ug+2ug) is transfected to a 60mm plate using lipofectamine 2000. Exosomes are extracted from the 4ml culture media using total exosome isolation kit (from cell culture media) from Invitrogen. Cells and exosomes are lysed using Ripa.
  
 
Cell content western blotting first proved successful translation of PNW3V plasmids inside HEK 293T cells. Exosome content shown pale fusion protein band around 30kda. TEM result of sample shown that the protein doesn’t effect the shape or the concentration of exosomes. COD result compared to normal exosomes shown that the COD value increased but the difference is not as huge as PNCV transfected once.
 
Cell content western blotting first proved successful translation of PNW3V plasmids inside HEK 293T cells. Exosome content shown pale fusion protein band around 30kda. TEM result of sample shown that the protein doesn’t effect the shape or the concentration of exosomes. COD result compared to normal exosomes shown that the COD value increased but the difference is not as huge as PNCV transfected once.
 +
 
[[File:T--SHSU_China--results3.jpg|600px|]]
 
[[File:T--SHSU_China--results3.jpg|600px|]]
  

Latest revision as of 14:36, 17 October 2018


WW Domain 3

WW Tag 3
Function Active Cargo Loading for Exosomes
Use in Mammalian cells
RFC standard RFC 10 compatible
Backbone pSB1C3
Submitted by [http://2018.igem.org/Team:SHSU_China SHSU_China]

Overview

WW domain is a 40 amino acid length domain that can primarily bind to PPxY motif. It was first discovered on NEDD4 protein, enabling NEDD4 to bind with Ndfip, thus initiating ubquitination. Soon the interaction between WW domain and PPxY motif was found in many irrelevant signaling pathway including viral gag proteins, interleukin receptors and several serine/threonine kinases , indicating a universal significance. It’s worth to mention that WW domain on NEDD4 specifically can bind to an in vitro PY motif, which permits a more flexible way for experiments.

T--SHSU China--NEDD4.png

Figure 1: NEDD4

In experiments, in order to obtain the best binding efficiency with PPxY motif, Team SHSU_China chose the third and fourth from all 4 WW domains on NEDD4 to continue.

Design

Team SHSU_China used sequence of WW domain 3 from Human Nedd4 sequence and added HindIII and XbaI when designing the sequence. The following primers are used to sequence the Tags:

WW Tag-Forward:CCGGAATTCCCCAAGCTTCGTCGTGCCT

WW3-Reverse:TGCACTGCAGGCTCTAGACGGAATTTTCAGACGCGGATCTT

T--SHSU China--plasmids.jpeg

Figure 2: Plasmids used in the experiments

Prove of Expression

Team SHSU_China used HEK 293T cells in their exosome experiments. After using sequencing to conform the sequence, 2ug of vector (or 2ug+2ug) is transfected to a 60mm plate using lipofectamine 2000. Exosomes are extracted from the 4ml culture media using total exosome isolation kit (from cell culture media) from Invitrogen. Cells and exosomes are lysed using Ripa.

Cell content western blotting first proved successful translation of PNW3V plasmids inside HEK 293T cells. Exosome content shown pale fusion protein band around 30kda. TEM result of sample shown that the protein doesn’t effect the shape or the concentration of exosomes. COD result compared to normal exosomes shown that the COD value increased but the difference is not as huge as PNCV transfected once.

T--SHSU China--results3.jpg

Figure 3: Results

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]