Difference between revisions of "Part:BBa K2885000"

Revision as of 13:30, 17 October 2018

Protien G (ProG)

Protein G (ProG), one of the immunoglobulin-binding proteins, was derived from two streptococcal strains (group C and G) and has been used for purification of antibodies due to its binding characteristic to antibodies’ Fab and Fc region (Sjobring et al., 1991). Some investigators studied that protein G bound to diverse immunoglobulin G (IgG) subtypes of mouse, rat, human, rabbit, and cow; nonetheless, chicken IgG did not (Akerström et al., 1985). Therefore, our ProG recombinant from Escherichia coli was used for efficient immobilization of antibodies, which enables us to develop our electrochemical biosensor.

The DNA sequences encoding ProG used in our experiment were derived from the genomic DNA of Staphylococcus aureus G418 (Park et al., 2014). The DNA fragment was obtained by PCR amplification using the primers (ProG F1 and R1) and by the plasmid pSB1C3-GBP-ProG as a template. The restriction enzyme sites are underlined.

ProG F1 (Forward) – TCTAGAATGAAGGGCGAAACA

ProG R1 (Reverse) – ACTAGTTTATTATTCGGTAAC

The PCR product of the ProG-encoding fragment was ligated with the TA vector. The ligated vector was digested with two restriction enzymes (XbaI and SpeI), and ligated into the XbaI and SpeI sites of pSB1C3 backbone plasmid. We checked appropriate insertion of the fragment in the vector by gel electrophoresis after reaction with the enzymes to verify the exact band scale. Figure 1 showed that lane 1, 2 is proper orientation producing pSB1C3-ProG.

References

[1] Akerström, B., Brodin, T., Reis, K., Björck, L. (1985). Protein G: a powerful tool for binding and detection of monoclonal and polyclonal antibodies. J. Immunol. 135(4), 2589-2592.

[2] Park, J.H., Kim, Y.P., Kim, I.H., Ko, S. Rapid detection of aflatoxin B1 by a bifunctional protein crosslinker-based surface plasmon resonance biosensor. (2014). Food Control 36(1), 183-190.

[3] Sjobring, U., Bjorck, L., Kastern, W. (1991). Streptococcal protein G. Gene structure and protein binding properties. J. Biol. Chem. 266(1), 399–405.

Sequence and Features