Difference between revisions of "Part:BBa K2550000:Experience"
(→Sequencing Analysis) |
(→Sequencing Analysis) |
||
| Line 16: | Line 16: | ||
===Sequencing Analysis=== | ===Sequencing Analysis=== | ||
TAATACGACTCACTATAGG | TAATACGACTCACTATAGG | ||
| + | |||
<i>Figure 3: Biobricked T7 promoter sequencing results.</i> | <i>Figure 3: Biobricked T7 promoter sequencing results.</i> | ||
GGGAGAGGGTATAAGTAAATCGCTTGCTGTATGTCGTTAAACAGAGGAGATAACGAATGACAGCAAGCAACCTGGCGGCAGCGCAAAAG | GGGAGAGGGTATAAGTAAATCGCTTGCTGTATGTCGTTAAACAGAGGAGATAACGAATGACAGCAAGCAACCTGGCGGCAGCGCAAAAG | ||
| + | |||
<i>Figure 4: Biobricked Toehold sequencing results which was used in the NuPack software to illustrate the functioning Toehold Switch .</i> | <i>Figure 4: Biobricked Toehold sequencing results which was used in the NuPack software to illustrate the functioning Toehold Switch .</i> | ||
ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAA | ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAA | ||
| + | |||
<i> Figure 5: Biobricked LacZ gene sequencing results that proved the 1 base pair wobble was successful.</i> | <i> Figure 5: Biobricked LacZ gene sequencing results that proved the 1 base pair wobble was successful.</i> | ||
Revision as of 14:14, 16 October 2018
Applications of BBa_K2550000
Figure 1: Toehold structure implemented in the T7 Toehold LacZ biobrick that was developed in the Nupack software which confirmed the shape of the toehold sequence.
The toehold sequence, part BBa_K2550100, is 108 bp long and was obtained from the 144 first generation orthogonal toehold switches collection from the 2017 Collins paper titled Toehold Switches: De-Novo-Designed Regulators of Gene Expression. This distinct riboregulator follows the T7 promoter that is assembled in the T7 Toehold LacZ biobrick. This image above is a visual representation of this unique toehold structure.
<PIC OF LEAKINESS VS DUAL PLASMID COLOR>
Figure 2: The T7 Toehold LacZ biobrick transformed on a chloramphenicol and xgal plate expressing blue pigment without trigger sequence as a result of the strong T7 promoter (Image on the left). T7 Toehold LacZ and trigger sequence transformed in a dual plasmid transformation on a carbenicillin, chloramphenicol, and xgal plate that is expressing a blue pigment due to presence of trigger sequence (Image on the right).
T7, part BBa_I719005, is a strong constitutive promoter derived from the T7 bacteriophage that expresses proteins in the presence of T7 polymerase. It was observed that the toehold expressed a blue pigment when inoculated into xgal and Luria Broth. Although a lighter shade than when fully induced, we hypothesize that this pigment is due to toehold leakiness as a result of the strength of the T7 promoter.
Sequencing Analysis
TAATACGACTCACTATAGG
Figure 3: Biobricked T7 promoter sequencing results.
GGGAGAGGGTATAAGTAAATCGCTTGCTGTATGTCGTTAAACAGAGGAGATAACGAATGACAGCAAGCAACCTGGCGGCAGCGCAAAAG
Figure 4: Biobricked Toehold sequencing results which was used in the NuPack software to illustrate the functioning Toehold Switch .
ATGACCATGATTACGGATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAA
Figure 5: Biobricked LacZ gene sequencing results that proved the 1 base pair wobble was successful.
User Reviews
UNIQde037d873fdcef10-partinfo-00000000-QINU
UNIQde037d873fdcef10-partinfo-00000001-QINU