Difference between revisions of "Part:BBa K2878006"
(3 intermediate revisions by 2 users not shown) | |||
Line 1: | Line 1: | ||
__NOTOC__ | __NOTOC__ | ||
− | <partinfo> | + | <partinfo>BBa_K2878006 short</partinfo> |
− | This DNA oligo consists of T7 promoter (TAATACGACTCACTATA) and | + | This DNA oligo consists of T7 promoter (TAATACGACTCACTATA) and ARK-shRNA-1 transcription template (GGACCGTCCGTTCGCCAAGCCCTTGCTTCGGCTTGGCGAACGGACGGTCCTT), We use this template for ARK-shRNA-1 generation through in vitro transcription system. With the DNA oligo of ARK-shRNA-1 template with T7 promoter, we add T7 RNA polymerase, NTP and in vitro transcription buffer, ARK-shRNA-1 can be generated within 30 minutes. ARK-shRNA-1 is designed to silence Phyllotreta striolata Aldose reductase gene, the target site on the Aldose reductase mRNA is 645-665 after AUG. |
<!-- Add more about the biology of this part here--> | <!-- Add more about the biology of this part here--> | ||
Line 18: | Line 18: | ||
==3. Characterization== | ==3. Characterization== | ||
− | ===3.1 Design of | + | ===3.1 Design of ARK-shRNA-1=== |
− | + | ARK-shRNA-1 was designed based on the mRNA sequences of Aldose Reductase. Factors that affect in vitro transcription efficiency, such as the requirement of a ‘GG’ dinucleotide at the start of the transcript; and factors that affect RNAi efficiency, such as distance of target region to transcription start site, nucleotide composition, and the presence of asymmetry and energy valley within the shRNA; were considered. <br> | |
These criteria include:<br><br> | These criteria include:<br><br> | ||
Target site: <br> | Target site: <br> | ||
Line 30: | Line 30: | ||
Weak base pairing at 5′-end of the antisense strand (presence of A/U) <br> | Weak base pairing at 5′-end of the antisense strand (presence of A/U) <br> | ||
Strong base pairing at 5′-end of the sense strand (presence of G/C) <br> | Strong base pairing at 5′-end of the sense strand (presence of G/C) <br> | ||
− | 5′-end of the antisense strand start with C (Insect agoraute2 prefers 5’ C)<br> | + | 5′-end of the antisense strand start with C (Insect agoraute2 prefers 5’ C)<br><br> |
− | Based on these criteria, | + | Based on these criteria, ARK-shRNA-1 that may target the Phyllotreta striolata Arginine Kinase gene was designed (Table 1). |
{| class="wikitable" | {| class="wikitable" | ||
Line 37: | Line 37: | ||
|- | |- | ||
|shRNA | |shRNA | ||
− | | | + | |ARK-shRNA-1 |
|- | |- | ||
|Sequence | |Sequence | ||
Line 55: | Line 55: | ||
|} | |} | ||
− | ===3.2 In vitro transcription of | + | ===3.2 In vitro transcription of ARK-shRNA-1=== |
====1) DNA Oligo Template Design==== | ====1) DNA Oligo Template Design==== | ||
− | For primer 1, convert the sense strand of the siRNA sequence to the corresponding DNA sequence, add a 17 base T7 promoter sequence (TAATACGACTCACTATA) to the 5’end of the DNA sequence, add an 8 base loop sequence to the 3’-end of the DNA sequence. For primer 2, add the antisense sequence complementary to the loop sequence to the 3’-end of the DNA sequence. add 2 AA’s to the 5’-end of the Primer 2 oligo. DNA | + | For primer 1, convert the sense strand of the siRNA sequence to the corresponding DNA sequence, add a 17 base T7 promoter sequence (TAATACGACTCACTATA) to the 5’end of the DNA sequence, add an 8 base loop sequence to the 3’-end of the DNA sequence. For primer 2, add the antisense sequence complementary to the loop sequence to the 3’-end of the DNA sequence. add 2 AA’s to the 5’-end of the Primer 2 oligo. DNA Oligo (Table 2) were ordered. |
{| class="wikitable" | {| class="wikitable" | ||
− | |+Table 2 Primers for acquisition of | + | |+Table 2 Primers for acquisition of ARK-shRNA-1 templates |
|- | |- | ||
|Primers for DNA oligo template | |Primers for DNA oligo template | ||
|Primers | |Primers | ||
|- | |- | ||
− | | | + | |ARK-shRNA-1 |
| P1: 5’ TAATACGACTCACTATA GGAGTTCGATGCCGTTAAGGA CTTGCTTC 3’<br>P2: 5’ AAGGAGTTCGATGCCGTTAAGGA GAAGCAAG 3’ | | P1: 5’ TAATACGACTCACTATA GGAGTTCGATGCCGTTAAGGA CTTGCTTC 3’<br>P2: 5’ AAGGAGTTCGATGCCGTTAAGGA GAAGCAAG 3’ | ||
|} | |} | ||
− | ====2) Fill-in reaction to generate | + | ====2) Fill-in reaction to generate ARK-shRNA-1 transcription templates==== |
Each fill-in Reaction was set up with two Oligos<br><br> | Each fill-in Reaction was set up with two Oligos<br><br> | ||
Line 78: | Line 78: | ||
0.5 µl 50 X dNTPs (10 mM)<br> | 0.5 µl 50 X dNTPs (10 mM)<br> | ||
0.5 µl Klenow Fragment exo– DNA Polymerase (5 U/ ml)<br> | 0.5 µl Klenow Fragment exo– DNA Polymerase (5 U/ ml)<br> | ||
− | 15 µl RNase-Free Water<br> | + | 15 µl RNase-Free Water<br><br> |
20 µl Total reaction volume, incubate the reaction mixtures for 2 hours at 37ºC, then 25 min at 75 ºC, cool at room temperature for 2 minutes.<br><br> | 20 µl Total reaction volume, incubate the reaction mixtures for 2 hours at 37ºC, then 25 min at 75 ºC, cool at room temperature for 2 minutes.<br><br> | ||
− | The integrity of | + | The integrity of ARK-shRNA-1 templates was identified through 3% agarose gel eletrophoresis (Fig. 1). Agarose gel electrophoresis showed that the ARK-shRNA-1 template was successfully generated. Sharp bands can be seen on the gel, and the size of the bands is around 69 bases, which is the correct size. |
− | [[File:T--SSHS-Shenzhen--80063.png|thumb|Fig 1. Detection of | + | [[File:T--SSHS-Shenzhen--80063.png|thumb|Fig 1. Detection of ARK-shRNA-1 templates by agarose gel (3%). The integrity of shRNA templates was identified through 3% agarose gel eletrophoresis (200 V, 30 min)]] |
====3) In vitro transcription==== | ====3) In vitro transcription==== | ||
Line 114: | Line 114: | ||
The procedure of the shRNA in vitro transcription system is illustrated in Fig. 2. | The procedure of the shRNA in vitro transcription system is illustrated in Fig. 2. | ||
− | [[File:T--SSHS-Shenzhen--80092.png|thumb|Fig. 2. Diagram illustrating the procedure of | + | [[File:T--SSHS-Shenzhen--80092.png|thumb|Fig. 2. Diagram illustrating the procedure of ARK-shRNA-1 in vitro transcription]] |
<br> | <br> | ||
− | The integrity of | + | The integrity of ARK-shRNA-1 was identified through 3% agarose gel eletrophoresis (Fig. 3) Agarose gel electrophoresis showed that the ARK-shRNA-1 was successfully transcribed. Sharp bands of around 52 bases in length were detected on the gel, the size of the bands is correct. |
− | [[File:T--SSHS-Shenzhen--80072.png|thumb|Fig 3. Detection of in vitro transcribed | + | [[File:T--SSHS-Shenzhen--80072.png|thumb|Fig 3. Detection of in vitro transcribed ARK-shRNA-1 by agarose gel (3%). The integrity of shRNA was identified through 3% agarose gel eletrophoresis (200 V, 30 min).]] |
===3.4 RNAi efficiency test=== | ===3.4 RNAi efficiency test=== | ||
Line 125: | Line 125: | ||
Adult P. striolata were obtained from Shenzhen University field station, and kept in glass bottles. The tissue culture seedlings of Chinese cabbage, Brassica chinensis leaves were placed into the above bottles (Fig. 4). | Adult P. striolata were obtained from Shenzhen University field station, and kept in glass bottles. The tissue culture seedlings of Chinese cabbage, Brassica chinensis leaves were placed into the above bottles (Fig. 4). | ||
− | [[File:T--SSHS-Shenzhen--80094.png|thumb|Fig.4. Adult P. striolata and Brassica chinensis leaves were placed into the glass bottles for RNAi efficiency test. | + | [[File:T--SSHS-Shenzhen--80094.png|thumb|Fig.4. Adult P. striolata and Brassica chinensis leaves were placed into the glass bottles for RNAi efficiency test. ARK-shRNA-1 sample has two repeats.]] |
<br> | <br> | ||
− | The solutions of | + | The solutions of ARK-shRNA-1 (10 ng/mL) was sprayed onto the leaves of Chinese cabbage every third day, each solution has two repeats. Around twenty adult beetles of P. striolata were tested per siRNA/shRNA sample. The survival rates of adult beetles, were recorded at different days after ARK-shRNA-1 treatment.<br><br> |
− | Results show that, | + | Results show that, ARK-shRNA-1 could trigger RNAi mechanism, which was demonstrated by the significant survival rate decrease after treatment, while the negative control sample showed slight survival rate decrease. |
− | [[File:T--SSHS-Shenzhen--80061.png|thumb|Fig. 5 The survival rate of Phyllotreta striolata at different days after | + | [[File:T--SSHS-Shenzhen--80061.png|thumb|Fig. 5 The survival rate of Phyllotreta striolata at different days after ARK-shRNA-1 treatment.]] |
==4. References== | ==4. References== | ||
Line 145: | Line 145: | ||
<!-- --> | <!-- --> | ||
<span class='h3bb'>Sequence and Features</span> | <span class='h3bb'>Sequence and Features</span> | ||
− | <partinfo> | + | <partinfo>BBa_K2878006 SequenceAndFeatures</partinfo> |
<!-- Uncomment this to enable Functional Parameter display | <!-- Uncomment this to enable Functional Parameter display | ||
===Functional Parameters=== | ===Functional Parameters=== | ||
− | <partinfo> | + | <partinfo>BBa_K2878006 parameters</partinfo> |
<!-- --> | <!-- --> |
Latest revision as of 11:38, 16 October 2018
ARK-shRNA-1 template with T7 promoter
This DNA oligo consists of T7 promoter (TAATACGACTCACTATA) and ARK-shRNA-1 transcription template (GGACCGTCCGTTCGCCAAGCCCTTGCTTCGGCTTGGCGAACGGACGGTCCTT), We use this template for ARK-shRNA-1 generation through in vitro transcription system. With the DNA oligo of ARK-shRNA-1 template with T7 promoter, we add T7 RNA polymerase, NTP and in vitro transcription buffer, ARK-shRNA-1 can be generated within 30 minutes. ARK-shRNA-1 is designed to silence Phyllotreta striolata Aldose reductase gene, the target site on the Aldose reductase mRNA is 645-665 after AUG.
1. Usage
In our project, ARK-shRNA-1 was used to silence Arginine Kinase gene of phylotreta striolata. ARK-shRNA-1 solution (10ng/ml) can be sprayed on leaves of cruciferous plants, ingestion of the ARK-shRNA-1 by P. striolata will induce the RNAi mechanism in the insect and lead to its death.
2. Biology
Eukaryotic organisms including insects possess this RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing multiple siRNAs. One strand of each siRNA is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanism can be triggered by introducing either dsRNA, siRNA or shRNA.
The target site for ARK-shRNA-1 on the Arginine Kinase mRNA is 997- 1018 after AUG. Arginine kinase participates in arginine metabolism, transferring phosphorus group from ATP to arginine. When gene for Arginine Kinase is silenced, phylotreta striolata is killed.
3. Characterization
3.1 Design of ARK-shRNA-1
ARK-shRNA-1 was designed based on the mRNA sequences of Aldose Reductase. Factors that affect in vitro transcription efficiency, such as the requirement of a ‘GG’ dinucleotide at the start of the transcript; and factors that affect RNAi efficiency, such as distance of target region to transcription start site, nucleotide composition, and the presence of asymmetry and energy valley within the shRNA; were considered.
These criteria include:
Target site:
Not being in the first 75 bases from the start codon
Not being in the intron.
Nucleotide content of siRNA:
GC content of ~50% GC content.
UU overhangs in 3′-end (increase siRNA stability)
Weak base pairing at 5′-end of the antisense strand (presence of A/U)
Strong base pairing at 5′-end of the sense strand (presence of G/C)
5′-end of the antisense strand start with C (Insect agoraute2 prefers 5’ C)
Based on these criteria, ARK-shRNA-1 that may target the Phyllotreta striolata Arginine Kinase gene was designed (Table 1).
shRNA | ARK-shRNA-1 |
Sequence | |
GC% of antisense strand | 48 |
GC% at 5′-end of antisense strand | 48 |
GC% at 3′-end of antisense strand | 48 |
Target site | 997- 1018 after AUG |
3.2 In vitro transcription of ARK-shRNA-1
1) DNA Oligo Template Design
For primer 1, convert the sense strand of the siRNA sequence to the corresponding DNA sequence, add a 17 base T7 promoter sequence (TAATACGACTCACTATA) to the 5’end of the DNA sequence, add an 8 base loop sequence to the 3’-end of the DNA sequence. For primer 2, add the antisense sequence complementary to the loop sequence to the 3’-end of the DNA sequence. add 2 AA’s to the 5’-end of the Primer 2 oligo. DNA Oligo (Table 2) were ordered.
Primers for DNA oligo template | Primers |
ARK-shRNA-1 | P1: 5’ TAATACGACTCACTATA GGAGTTCGATGCCGTTAAGGA CTTGCTTC 3’ P2: 5’ AAGGAGTTCGATGCCGTTAAGGA GAAGCAAG 3’ |
2) Fill-in reaction to generate ARK-shRNA-1 transcription templates
Each fill-in Reaction was set up with two Oligos
1.0 µl P1 Oligo (100 pmoles)
1.0 µl P2 Oligo (100 pmoles)
2.0 µl 10 x buffer 2 (NEB)
0.5 µl 50 X dNTPs (10 mM)
0.5 µl Klenow Fragment exo– DNA Polymerase (5 U/ ml)
15 µl RNase-Free Water
20 µl Total reaction volume, incubate the reaction mixtures for 2 hours at 37ºC, then 25 min at 75 ºC, cool at room temperature for 2 minutes.
The integrity of ARK-shRNA-1 templates was identified through 3% agarose gel eletrophoresis (Fig. 1). Agarose gel electrophoresis showed that the ARK-shRNA-1 template was successfully generated. Sharp bands can be seen on the gel, and the size of the bands is around 69 bases, which is the correct size.
3) In vitro transcription
1. in vitro transcription reaction was set up using the prepared template.
10.7 µl RNase-Free Water
2.0 µl Fill-In Reaction product
2.0 µl 10 x T7 RNA Polymerase Buffer (NEB)
2.8 µl 100mM MgSO4 (NEB)
1.0 µl NTP Mix (80 mM each NTP)
1.5 µl T7 RNA Polymerase (50 U/ µl)
20 ul Total reaction volume
2. Incubate the reaction mixtures for 2-3 hours at 37ºC.
3. Add 1 µl RNase-Free DNase I (1 Unit/ml) to remove the DNA template, 37ºC 15 min.
4. Heat the reaction mixtures for 15 minutes at 70ºC to inactivate the enzyme.
5. Extract with Phenol/Chloroform.
a. Add 100 µl RNase-Free Water to dilute the reaction.
b. Add 120 µl phenol/chloroform and vortex briefly to mix.
c. Spin in a microfuge for 1 minute at full speed.
d. Carefully pipette off the top aqueous phase and transfer to a clean tube.
6. Precipitate the shRNA.
a. To the recovered aqueous phase, add 1/10 vol. of 3 M Sodium Acetate (pH 5.2).
b. Add 2.5 volumes of 95-100% ethanol.
c. Incubate for 15 minutes on ice.
d. Pellet the shRNA in a microfuge by spinning at full speed for 15 minutes.
e. Remove the supernatant.
f. Carefully wash the pellet once with 70% ethanol.
g. Air dry the pellet for only 2-5 minutes.
7. Add 100 µl of the 1 X Annealing Buffer to the shRNA pellet and resuspend the shRNA.
The procedure of the shRNA in vitro transcription system is illustrated in Fig. 2.
The integrity of ARK-shRNA-1 was identified through 3% agarose gel eletrophoresis (Fig. 3) Agarose gel electrophoresis showed that the ARK-shRNA-1 was successfully transcribed. Sharp bands of around 52 bases in length were detected on the gel, the size of the bands is correct.
3.4 RNAi efficiency test
Adult P. striolata were obtained from Shenzhen University field station, and kept in glass bottles. The tissue culture seedlings of Chinese cabbage, Brassica chinensis leaves were placed into the above bottles (Fig. 4).
The solutions of ARK-shRNA-1 (10 ng/mL) was sprayed onto the leaves of Chinese cabbage every third day, each solution has two repeats. Around twenty adult beetles of P. striolata were tested per siRNA/shRNA sample. The survival rates of adult beetles, were recorded at different days after ARK-shRNA-1 treatment.
Results show that, ARK-shRNA-1 could trigger RNAi mechanism, which was demonstrated by the significant survival rate decrease after treatment, while the negative control sample showed slight survival rate decrease.
4. References
[1] Baum J.A., Bogaert T., Clinton W., Heck G.R., Feldmann P., Ilagen O., Johnson S., Plaetinck G., Munyikwa T., Pleau M., Vaughn T., Roberts J. 2007: Control of coleopteran insect pests through RNA interference. Nat. Biotech. 25: 1322–1326.
[2] Gorden K.H. & Waterhouse P.M. 2007: RNAi for insect-proof plants. Nat. Biotech.25: 1231–1232.
[3] Macrae I.J., Zhou K., Li F., Repic A., Brooks A.N., Cande W.Z., Adams P.D., Doudna J.A. 2006: Structural basis for double-stranded RNA processing by Dicer. Science. 311 (5758): 195–8.
[4] Mao Y.B., CAI W.J., WANG J.W., HONG G.J., TAO X.Y., WANG L.J., HUANG Y.P., CHEN X.Y. 2007: Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotech. 25: 1307–1313.
[5] Turner C.T., Davy M.W., Macdiarmid R.M., Plummer K.M., Birch N.P., Newcomb R.D. 2006: RNA interference in the light brown apple moth, Epiphyas postvittana (Walker) induced by double-stranded RNA feeding. Insect Mol. Biol. 15: 383–391.
[6] Wang M, Weiberg A, Lin F M, et al. Bidirectional cross-kingdom RNAi and fungal uptake of external RNAs confer plant protection[J]. Nature Plants, 2016, 2(10):16151-16151.
[7] Zhao Y.Y., Yang G., Pruski W., You M.S. 2008: Phyllotreta striolata (Coleoptera: Chrysomelidae): arginine kinase cloning and RNAi-based pest control. Eur J Entomol 105: 815–822.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]