Difference between revisions of "Part:BBa K2834003"
Line 35: Line 35:
 
</b>
 
</b>
 
1. Casteels, P., Ampe, C., Jacobs, F., Vaeck, M., & Tempst, P. (1989). Apidaecins: antibacterial peptides from honeybees. The EMBO Journal, 8(8), 2387–2391.
 
1. Casteels, P., Ampe, C., Jacobs, F., Vaeck, M., & Tempst, P. (1989). Apidaecins: antibacterial peptides from honeybees. The EMBO Journal, 8(8), 2387–2391.
 +
<br>
 
2. Mishra, A., Choi, J., Moon, E., & Baek, K.-H. (2018). Tryptophan-Rich and Proline-Rich Antimicrobial Peptides. Molecules, 23(4), 815. https://doi.org/10.3390/molecules23040815
 
2. Mishra, A., Choi, J., Moon, E., & Baek, K.-H. (2018). Tryptophan-Rich and Proline-Rich Antimicrobial Peptides. Molecules, 23(4), 815. https://doi.org/10.3390/molecules23040815
 +
<br>
 
3. Wei-Fenm L., Guo-Xia, M., & Xu-Xia, Z. (2006). Apidaecin-type peptides: Biodiversity, structure–function relationships and mode of action. National Institute for Biotechnology Information. 10.1016/j.peptides.2006.03.016
 
3. Wei-Fenm L., Guo-Xia, M., & Xu-Xia, Z. (2006). Apidaecin-type peptides: Biodiversity, structure–function relationships and mode of action. National Institute for Biotechnology Information. 10.1016/j.peptides.2006.03.016
 
<br>
 
<br>

Revision as of 04:46, 15 October 2018

Expressible apidaecin antimicrobial peptide from Apis mellifera

This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, apidaecin, a 6x His-Tag, and a T1 terminator from E. coli. This composite enables the expression of apidaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.


As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 2 and the His-tag. The exact synthesized sequence is:
CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTC


Usage and Biology

In the last few years a lot of effort has been concentrated in the search of new alternative treatments against infections. Apidaecins are antimicrobial peptides isolated from lymph fluid of the adult honeybee that have come to address this necessityM. Structurally, these peptides are composed of 18 residues, containing 6 prolines (33%). This composition provides Apidaecin with antibacterial capacity, high stability at acidic conditions, and helical structureC. These properties have made Apidaecin a useful resource for the

Apidaecins222222222222222222222.

Sequence and Features

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 86
  • 1000
    COMPATIBLE WITH RFC[1000]


References

1. Casteels, P., Ampe, C., Jacobs, F., Vaeck, M., & Tempst, P. (1989). Apidaecins: antibacterial peptides from honeybees. The EMBO Journal, 8(8), 2387–2391.
2. Mishra, A., Choi, J., Moon, E., & Baek, K.-H. (2018). Tryptophan-Rich and Proline-Rich Antimicrobial Peptides. Molecules, 23(4), 815. https://doi.org/10.3390/molecules23040815
3. Wei-Fenm L., Guo-Xia, M., & Xu-Xia, Z. (2006). Apidaecin-type peptides: Biodiversity, structure–function relationships and mode of action. National Institute for Biotechnology Information. 10.1016/j.peptides.2006.03.016