Difference between revisions of "Part:BBa K2591011"

Revision as of 01:18, 12 October 2018

gWls-scaffold

Usage and Biology

Naturally, single guide RNA(sgRNA) is a small RNA which guide CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in the gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, Nat. Protoc., 2013)

Figure1. Schematic of the RNA-guided Cas9 nuclease.(Ran, et al, Nat. Protoc., 2013) In our project, we design this gRNA for wntless WNT ligand secretion mediator (Wls), and it is a functional protein for the secretion of the Wnt3A protein and assist the modification for the mature Wnt3A protein. Therefore, if we transfect the gRNA of Wls into cells, we can inhibit the donor cell to secret the Wnt3A protein normally. And we have integrated this gRNA together with its scaffold into the backbone pSB1C3 to get a new part.(Fig2)

Figure2. Diagram of pSB1C3_gRNA_scaffold.

Characterization

length: 20 nt target sequence: TGACAAGATCCGTGACATCG primer for plasmid construction: Wls-gRNA-F 5' -CACCGTGACAAGATCCGTGACATCG- 3' Wls-gRNA-R 5' -AAACCGATGTCACGGATCTTGTCAC- 3' location in gene loci:

Figure 3. the gRNA is designed to target a conserved exon of Wls of mouse (From NCBI) As mentioned above, knockout of PORCN will impair the Wnt3a secretion activity in the cells. Therefore, we first introduce sgPor into L-Wnt3A-Cas9-mCherry cell line, which continuously expresses Cas9 protein. And then coculture with our Wnt3a reception cell, 293R-TCF-EGFP cell, then observed the fluorescence after one day to validate our part. We also observed the validated results using FACS. Validation images are shown in Fig4 and Fig5.

Figure4. Knockout of WLS show no wnt secretion, fluorescence validation. First row: normal 293R cell line. Second row: 293R cell line cultured with L-cell with WLS knockout. Third row: 293R cell line cultured with L-cell with no target knockout. Column legends indicated the observation field, merged means artificial adding of red and green. We cannot see green fluorescent protein at the green filed(475nm), it means the Wnt3A protein cannot be secreted from the L cell normally, and the gRNA designed for WLS could target specific sequence and did mutate it with Cas9 protein.

Figure5. Knockout of WLS show no wnt secretion, FACS validation. (a) Coculture of L cell-NON-target-KO with 293R-TCF-GFP in 24 hours. (b) Coculture of L cell-NON-target-KO with 293R-TCF-GFP in 0 hours. (c) Coculture of L cell-WLS-KO with 293R-TCF-GFP in 24 hours.

Sequence and Features