Difference between revisions of "Part:BBa K2591022"
Line 3: | Line 3: | ||
<partinfo>BBa_K2591022 short</partinfo> | <partinfo>BBa_K2591022 short</partinfo> | ||
− | |||
− | |||
− | |||
===Usage and Biology=== | ===Usage and Biology=== | ||
+ | |||
+ | |||
+ | Naturally, single guide RNA(sgRNA) is a small RNA which guide CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in the gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, Nat. Protoc., 2013) | ||
+ | |||
+ | |||
+ | |||
+ | Figure1. Schematic of the RNA-guided Cas9 nuclease.(Ran, et al, Nat. Protoc., 2013) | ||
+ | |||
+ | |||
+ | |||
+ | In our project, we design this gRNA for wingless-type MMTV integration site family, member 3A (Wnt3A). Wnt3A protein is a secretion protein function in the development and proliferation of the normal cell, and more importantly, canonical Wnt pathway play a role in the induction of cancer. In our part, we want to explore the upstream of the Wnt pathway, and want to find the gene factors which affect the Wnt pathway by the high-throughput double emulsion system. Thus, we design this gRNA for Wnt protein coding sequence as a positive control. | ||
+ | |||
+ | |||
+ | Figure2. Diagram of pSB1C3_gRNA_scaffold. | ||
+ | |||
+ | |||
+ | ===Characterization=== | ||
+ | |||
+ | |||
+ | target length: 20nt | ||
+ | |||
+ | target sequence: ACCGTCACAACAATGAGGCT | ||
+ | |||
+ | primer for plasmid construction: | ||
+ | |||
+ | wnt3a-gRNA1-F 5' -CACCGACCGTCACAACAATGAGGCT- 3' | ||
+ | |||
+ | wnt3a-gRNA1-R 5' -AAACAGCCTCATTGTTGTGACGGTC- 3' | ||
+ | |||
+ | |||
+ | Location in gene loci: | ||
+ | |||
+ | |||
+ | |||
+ | As mentioned above, knockout of Wnt3A will impair the Wnt3a secretion activity in the cells. Therefore, we first introduce sgWnt3A into L-Wnt3A-Cas9-mCherry cell line, which continuously expresses Cas9 protein. And then coculture with our Wnt3a reception cell, 293R-TCF-EGFP cell, then observed the fluorescence after one day to validate our part. Validation images are shown in Fig3. | ||
+ | |||
+ | |||
+ | |||
+ | Figure 4. 293R-TCF-EGFP cell line coculture with the L-Wnt3A-Cas9-mCherry-gRNA_Wnt3A cell line in 24h as a positive control group. (a) observe with white light; (b) observe at 475nm; (c) observe at 556nm. We can see the fluorescent protein at the 475nm and 556nm, it means the Wnt3A protein can be secreted from the L cell normally, and the gRNA designed for Wnt3A could target specific sequence and mutate it with Cas9 protein. | ||
+ | |||
+ | |||
<!-- --> | <!-- --> |
Revision as of 18:00, 11 October 2018
A gRNA designed to Wnt3A, an essential gene to secretion of the canonical wnt protein
Usage and Biology
Naturally, single guide RNA(sgRNA) is a small RNA which guide CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in the gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, Nat. Protoc., 2013)
Figure1. Schematic of the RNA-guided Cas9 nuclease.(Ran, et al, Nat. Protoc., 2013)
In our project, we design this gRNA for wingless-type MMTV integration site family, member 3A (Wnt3A). Wnt3A protein is a secretion protein function in the development and proliferation of the normal cell, and more importantly, canonical Wnt pathway play a role in the induction of cancer. In our part, we want to explore the upstream of the Wnt pathway, and want to find the gene factors which affect the Wnt pathway by the high-throughput double emulsion system. Thus, we design this gRNA for Wnt protein coding sequence as a positive control.
Figure2. Diagram of pSB1C3_gRNA_scaffold.
Characterization
target length: 20nt
target sequence: ACCGTCACAACAATGAGGCT
primer for plasmid construction:
wnt3a-gRNA1-F 5' -CACCGACCGTCACAACAATGAGGCT- 3'
wnt3a-gRNA1-R 5' -AAACAGCCTCATTGTTGTGACGGTC- 3'
Location in gene loci:
As mentioned above, knockout of Wnt3A will impair the Wnt3a secretion activity in the cells. Therefore, we first introduce sgWnt3A into L-Wnt3A-Cas9-mCherry cell line, which continuously expresses Cas9 protein. And then coculture with our Wnt3a reception cell, 293R-TCF-EGFP cell, then observed the fluorescence after one day to validate our part. Validation images are shown in Fig3.
Figure 4. 293R-TCF-EGFP cell line coculture with the L-Wnt3A-Cas9-mCherry-gRNA_Wnt3A cell line in 24h as a positive control group. (a) observe with white light; (b) observe at 475nm; (c) observe at 556nm. We can see the fluorescent protein at the 475nm and 556nm, it means the Wnt3A protein can be secreted from the L cell normally, and the gRNA designed for Wnt3A could target specific sequence and mutate it with Cas9 protein.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]