Difference between revisions of "Part:BBa K2878004"
Line 5: | Line 5: | ||
This DNA oligo is GLS-shRNA-2 transcription template (GGCGTACATCGATCAACGTCCTTGCTTCGACGTTGATCGATGTACGCCTT), We use this template for GLS-shRNA-2 generation through in vitro transcription system. GLS-shRNA-2 is designed to silence Phyllotreta striolata Glutathione S-transferase gene, the target site on the Glutathione S-transferase mRNA is 576-596 after AUG | This DNA oligo is GLS-shRNA-2 transcription template (GGCGTACATCGATCAACGTCCTTGCTTCGACGTTGATCGATGTACGCCTT), We use this template for GLS-shRNA-2 generation through in vitro transcription system. GLS-shRNA-2 is designed to silence Phyllotreta striolata Glutathione S-transferase gene, the target site on the Glutathione S-transferase mRNA is 576-596 after AUG | ||
− | <!-- Add more about the biology of this part here | + | <!-- Add more about the biology of this part here--> |
− | + | ==Usage== | |
+ | In our project, GLS-shRNA-2 was used to silence Glutathione S-transferase gene of phylotreta striolata. GLS-shRNA-2 solution (10ng/ml) can be sprayed on leaves of cruciferous plants, ingestion of the GLS-shRNA-2 by P. striolata will induce the RNAi mechanism in the insect and lead to its death. | ||
+ | ==Biology== | ||
+ | Eukaryotic organisms including insects possess this RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing multiple siRNAs. One strand of each siRNA is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanism can be triggered by introducing either dsRNA, siRNA or shRNA. | ||
+ | <br> | ||
+ | The target site for GLS-shRNA-2 on the Glutathione S-transferase mRNA is 576-595 after AUG. Glutathione S-transferase catalyze the conjugation of the reduced form of glutathione (GSH) to xenobiotic substrates for the purpose of detoxification. When gene for Glutathione S-transferase is silenced, phylotreta striolata is killed. | ||
+ | <br><br> | ||
<!-- --> | <!-- --> |
Revision as of 13:02, 9 October 2018
GLS-shRNA-2 template
This DNA oligo is GLS-shRNA-2 transcription template (GGCGTACATCGATCAACGTCCTTGCTTCGACGTTGATCGATGTACGCCTT), We use this template for GLS-shRNA-2 generation through in vitro transcription system. GLS-shRNA-2 is designed to silence Phyllotreta striolata Glutathione S-transferase gene, the target site on the Glutathione S-transferase mRNA is 576-596 after AUG
Usage
In our project, GLS-shRNA-2 was used to silence Glutathione S-transferase gene of phylotreta striolata. GLS-shRNA-2 solution (10ng/ml) can be sprayed on leaves of cruciferous plants, ingestion of the GLS-shRNA-2 by P. striolata will induce the RNAi mechanism in the insect and lead to its death.
Biology
Eukaryotic organisms including insects possess this RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing multiple siRNAs. One strand of each siRNA is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanism can be triggered by introducing either dsRNA, siRNA or shRNA.
The target site for GLS-shRNA-2 on the Glutathione S-transferase mRNA is 576-595 after AUG. Glutathione S-transferase catalyze the conjugation of the reduced form of glutathione (GSH) to xenobiotic substrates for the purpose of detoxification. When gene for Glutathione S-transferase is silenced, phylotreta striolata is killed.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]