Difference between revisions of "Part:BBa K2878005"

 
Line 5: Line 5:
 
This DNA oligo is ALR-shRNA-2 transcription template (GGACCGTCCGTTCGCCAAGCCCTTGCTTCGGCTTGGCGAACGGACGGTCCTT), We use this template for ALR-shRNA-2 generation through in vitro transcription system. ALR-shRNA-2 is designed to silence Phyllotreta striolata Aldose reductase gene, the target site on the Aldose reductase mRNA is 645-665 after AUG.
 
This DNA oligo is ALR-shRNA-2 transcription template (GGACCGTCCGTTCGCCAAGCCCTTGCTTCGGCTTGGCGAACGGACGGTCCTT), We use this template for ALR-shRNA-2 generation through in vitro transcription system. ALR-shRNA-2 is designed to silence Phyllotreta striolata Aldose reductase gene, the target site on the Aldose reductase mRNA is 645-665 after AUG.
  
<!-- Add more about the biology of this part here
+
<!-- Add more about the biology of this part here-->
===Usage and Biology===
+
==Usage==
 +
In our project, ALR-shRNA-2 was used to silence Aldose Reductase gene of phylotreta striolata. ALR-shRNA-2 solution (10ng/ml) can be sprayed on leaves of cruciferous plants, ingestion of the ALR-shRNA-2 by P. striolata will induce the RNAi mechanism in the insect and lead to its death.
 +
 
 +
==Biology==
 +
Eukaryotic organisms including insects possess this RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing multiple siRNAs. One strand of each siRNA is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanism can be triggered by introducing either dsRNA, siRNA or shRNA.
 +
<br>
 +
The target site for ALR-shRNA-2 on the Aldose Reductase mRNA is 645-665 after AUG. Aldose Reductase catalyzes the reduction of glucose to sorbitol, the first step in glucose metabolism. When gene for Aldose Reductase is silenced, phylotreta striolata is killed.
 +
<br><br>
  
 
<!-- -->
 
<!-- -->

Revision as of 13:01, 9 October 2018


ALR-shRNA-2 template

This DNA oligo is ALR-shRNA-2 transcription template (GGACCGTCCGTTCGCCAAGCCCTTGCTTCGGCTTGGCGAACGGACGGTCCTT), We use this template for ALR-shRNA-2 generation through in vitro transcription system. ALR-shRNA-2 is designed to silence Phyllotreta striolata Aldose reductase gene, the target site on the Aldose reductase mRNA is 645-665 after AUG.

Usage

In our project, ALR-shRNA-2 was used to silence Aldose Reductase gene of phylotreta striolata. ALR-shRNA-2 solution (10ng/ml) can be sprayed on leaves of cruciferous plants, ingestion of the ALR-shRNA-2 by P. striolata will induce the RNAi mechanism in the insect and lead to its death.

Biology

Eukaryotic organisms including insects possess this RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing multiple siRNAs. One strand of each siRNA is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanism can be triggered by introducing either dsRNA, siRNA or shRNA.
The target site for ALR-shRNA-2 on the Aldose Reductase mRNA is 645-665 after AUG. Aldose Reductase catalyzes the reduction of glucose to sorbitol, the first step in glucose metabolism. When gene for Aldose Reductase is silenced, phylotreta striolata is killed.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]