Difference between revisions of "Part:BBa J45003:Design"

(Primers)
 
(6 intermediate revisions by 2 users not shown)
Line 1: Line 1:
==Primers==
+
==Design Consideration==
Forward primer: 5'-  GTT TCT TCG AAT TCG CGG CCG CTT CTA G<b>at gga ggt aat gcg agt tct tc</b> -3'
+
*Attempted but failed to construct by PCR
  
Reverse primer: 5'- <b>accggttctaacgagcgaaag</b> -3'
+
====Forward primer====
 +
<code>5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA G'''at gga ggt aat gcg agt tct tc''' -3'</code>
  
==Design Consideration==
+
====Reverse primer====
This part would be used to make a jasmine scent.
+
<code>5'- GTT TCT TCC TGC AGC GGC CGC TAC TAG TAT TAT TA'''a ccg gtt cta acg agc gaa ag''' -3'</code>
  
 
==Source==
 
==Source==
If we find a source, it will probably be donated by Seo et al.  
+
''JMT'' from ''Arabidopsis thaliana'' ([http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=13676828 GenBank AY008434])
GENBANK Accession Number = BD441046
+
  
 
==References==
 
==References==
Seo HS, Song JT, Cheong JJ, Lee YH, Lee YW, Hwang I, Lee JS, and Choi YD. Jasmonic acid carboxyl methyltransferase: a key enzyme for jasmonate-regulated plant responses. Proc Natl Acad Sci U S A 2001 Apr 10; 98(8) 4788-93. doi:10.1073/pnas.081557298 pmid:11287667. PubMed HubMed [Seo01]
+
<biblio>
 +
#Seo-PNAS-2001 pmid=11287667
 +
</biblio>
 +
 
 +
[http://openwetware.org/wiki/IGEM:MIT/2006/Notebook/2006-6-6 MIT iGEM 2006 notebook entry]

Latest revision as of 17:35, 10 March 2008

Design Consideration

  • Attempted but failed to construct by PCR

Forward primer

5'- GTT TCT TCG AAT TCG CGG CCG CTT CTA Gat gga ggt aat gcg agt tct tc -3'

Reverse primer

5'- GTT TCT TCC TGC AGC GGC CGC TAC TAG TAT TAT TAa ccg gtt cta acg agc gaa ag -3'

Source

JMT from Arabidopsis thaliana ([http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=13676828 GenBank AY008434])

References

<biblio>

  1. Seo-PNAS-2001 pmid=11287667

</biblio>

[http://openwetware.org/wiki/IGEM:MIT/2006/Notebook/2006-6-6 MIT iGEM 2006 notebook entry]