Difference between revisions of "Part:BBa K2571005"

Revision as of 15:33, 3 October 2018

Bifunctional gamma-glutamate-cysteine ligase/Glutathione synthetase

Bifunctional gamma-glutamate-cysteine ligase/glutathione synthetase

Glutathione (GSH) is an important antioxidant that has a sulfur compound; a tripeptide composed of three amino acids (cysteine, glycine and glutamic acid) and a non-protein thiol (Pizzorno, 2014; Lu, 2013). GSH is generally found in the thiol-reduced from which is crucial for detoxification of ROS and free radicals which cause oxidative stress (Lu, 2013; Burton & Jauniaux, 2011).

Reactive Oxygen Species are dangerous substances that distort protein based matters by taking electrons (Lu, 2013). The chemical structure of the protein-based substances are altered and become dysfunctional because of ROS (Lu, 2013; Burton & Jauniaux, 2011). Furthermore, one of the most significant protein-based substance, DNA get attacked by OH radicals (Burton & Jauniaux, 2011). However, the reduced form GSH can protect the chemical structure of the proteins by giving extra electrons to the ROS and free radicals (Lu, 2013). This is accomplished by GSH peroxidase-catalyzed reactions (Lu, 2013).

Source:

Gene: GSH Protein: Bifunctional gamma-glutamate cysteine ligase <stron> Organism:</strong> Streptococcus Thermophilus (SIIM B218)

3D protein structure of Bifunctional gamma-glutamate-cysteine ligase, METU_HS_Ankara, 2018

Figure represents the predicted three-dimensional structure Bifunctional gamma-glutamate-cysteine ligase from Streptococcus Thermophilus . The protein structure of Bifunctional gamma-glutamate-cysteine ligase was constructed by using Amber 14. It is demonstrated in the ribbon diagram which is done by interpolating a smooth curve through the polypeptide backbone. The colors indicate the amino acids in the protein structure. While constructing, the codon bias rule is obeyed to express the enzyme in Escherichia Coli KO11.

Our circuit design for GSH gene

Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), GSH as protein coding region, double terminator (B0015) and suffix. This part enables our E. coli KO11 strain to overexpress oxidised Glutathione to reduce oxidative stress, increasing its lifespan. (Lu, 2013) Our construct is inserted into pSB1C3 and delivered to the Registry.

Circuit design of BBa_K2571005. Our construct includes a strong promoter,RBS, GSH and double terminator.

In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting the amino acid sequence. We looked through the codon bias property of E.coli and made the nucleotide changes accordingly.

Because Glutathione prevents the ROS from harming the bacteria, in high glutathione concentration increase in cell mass was observed. In brief, when glutathione concentration increases, the specific cell growth rate also increases and we observe increase in number of bacteria compared to the bacteria without GSH gene (Kim & Hahn , 2013).

BBa_K2571005 check with GSH specific primers. Expected band length: 225 bp. Last six wells show positive results.

We’ve inserted the GSH composite part to pSB1C3 backbone. Then, we’ve transformed the construct for submission, BBa_K2571005, (in pSB1C3) to DH5 alpha and conducted colony PCR. We’ve made the PCR with GSH specific primers and expected to see a result of 225 bp. PCR Results of our GSH part with GSH left and GSH right primers. By showing the band we expected, 225 bp, PCR confirmation for our insertion proved right.

GSH left and right primers are shown as below:

GSH left: TCGGAGGCTAAAACTCAGGA

GSH right: GTGGGCAGTCCAGTCGTAAT

Sequence and Features