Difference between revisions of "Part:BBa K2571000"

Revision as of 15:08, 3 October 2018

FucO/ L-1,2-Propanediol Oxidoreductase

1,2-propanediol oxidoreductase from E. coli has NADH-dependent furan reductase activity. L-1,2-propanediol oxidoreductase is an iron-dependent group III dehydrogenase

Usage and Biology

FucO is the gene that codes for L-1,2-propanediol oxidoreductase which is an NADH-linked, homodimer enzyme having the role of acting on furfural which is a toxic inhibitor of microbial fermentations causing cell wall and membrane damage, DNA breaks down and reduced enzymatic activities (Zheng, 2013; Liu, Ma & Song, 2009). L-propanediol oxidoreductase is composed of two subunits with an alpha/beta Rossman nucleotide binding N-terminal domain and an all- alpha-helical C-terminal domain. (Wang et al., 2011). It belongs to iron-activated group III dehydrogenase family and also called lactaldehyde reductase (Wang et al., 2011).

The enzyme catalyzes L-lactaldehyde and L-1,2- propanediol while dissimilating fucose in which acetaldehyde, ethylene glycerol, L-lactaldehyde, and some more substances are used as substrates. Despite these, it takes an important role in furan reduction to its alcohol derivative (Wang et al., 2011). Moreover, the crystal structure of L-1,2-propanediol oxidoreductase is shown to be so similar with YqhD which also functions in furfural reduction (Wang et al., 2011).

3D protein structure of L-1,2-propanediol oxidoreductase, METU_HS_Ankara, 2018

Figure represents the predicted three-dimensional structure of 1,2-propanediol oxidoreductase from E. coli . The protein structure of L-1,2-propanediol oxidoreductase was constructed by using Amber 14. It is demonstrated in the ribbon diagram which is done by interpolating a smooth curve through the polypeptide backbone. The colors indicate the amino acids in the protein structure. While constructing, the codon bias rule is obeyed to express the enzyme in Escherichia Coli KO11.

Wang et al ., 2011

When furfural is present in the field, the metabolism of furfural by NADPH-dependent oxidoreductases goes active in order to reduce it to its less toxic alcohol derivative - furfuryl alcohol (Zheng, 2013; Wang et al. , 2013; Allen et al. , 2010). In this metabolism, the expression of oxidoreductases that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and fermentation in Escherichia coli by competing with biosynthesis for NADPH (Zheng, 2013). Therefore, the NADPH that functions as electron carriers in approximately 70 redox reactions and Pentose Phosphate Pathway’s NADPH which is an essential cofactor for self-protection against cellular stress, become poorly functional ( Allen et al., 2010; Chou et al., 2015). Because the native conversion of NADH to NADPH in E. coli is insufficient to revitalize the NADPH pool during fermentation, the actions shouldn’t be interfering with NADPH metabolism (Wang et al, 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol oxidoreductase (FucO) gene may reduce furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis of NADPH (Wang et al, 2011).

Gel Characterization

FucO basic part is inserted into the pSB1C3 backbone. The construct in pSB1C3 is for submission to the registry and is cultivated in DH5 alpha.

BBa_K2571000 check with FucO left and VR primers. Expected band length: 625 bp. FucO basic well show positive results.

FucO and VR primers are as below:

FucO left: GTGATAAGGATGCCGGAGAA

VR: ATTACCGCCTTTGAGTGAGC

Allergenity Characterization

Our parts can be used in ethanol production and we used it in the lab for mass production, it was important to construct an allergenicity test. The allergenicity test makes a comparison between the sequences of the biobrick parts and the identified allergen proteins in the database. If the similarity between the biobricks and the proteins is high, it is more likely that the biobrick is allergenic. In the sliding window of 80 amino acid segments, greater than 35% means similarity to allergens. Higher similarity implies that the biobricks have a potential for negative effect to exposed populations. For more information on the protocol see the “Allergenicity Testing Protocol” in the following page http://2017.igem.org/Team:Baltimore_Bio-Crew/Experiments

Our biobrick part, BBa_K2571000 showed less than 35% match in the 80 amino acid alignments by FASTA.

Sequence and Features

References

Wang, X., Miller, E. N., Yomano, L. P., Zhang, X., Shanmugam, K. T., & Ingram, L. O. (2011). Increased Furfural Tolerance Due to Overexpression of NADH-Dependent Oxidoreductase FucO in Escherichia coli Strains Engineered for the Production of Ethanol and Lactate. Applied and Environmental Microbiology, 77(15), 5132–5140. http://doi.org/10.1128/AEM.05008-11

Zheng, H., Wang, X., Yomano, L.P., Geddes, R. D, Shanmugan, K. T., Ingram, L.O. (2013). Improving Escherichia coli FucO for Furfural Tolerance by Saturation Mutagenesis of Individual Amino Acid Positions. Applied and Environmental Microbiology Vol 79, no 10. 3202–3208. http://aem.asm.org/content/79/10/3202.full.pdf+html

Allen, S. A., Clark, W., McCaffery, J. M., Cai, Z., Lanctot, A., Slininger, P. J., … Gorsich, S. W. (2010). Furfural induces reactive oxygen species accumulation and cellular damage in Saccharomyces cerevisiae. Biotechnology for Biofuels, 3, 2. http://doi.org/10.1186/1754-6834-3-2

Chou, H.-H., Marx, C. J., & Sauer, U. (2015). Transhydrogenase Promotes the Robustness and Evolvability of E. coli Deficient in NADPH Production. PLoS Genetics, 11(2), e1005007. http://doi.org/10.1371/journal.pgen.1005007

Liu, Z.L., Ma M., Song, M.(2009). Evolutionarily engineered ethanologenic yeast detoxifies lignocellulosic biomass conversion inhibitors by reprogrammed pathways. Mol Genet Genomics 282, 233-244. doi: 10.1007/s00438-009-0461-7

Wang, X., Yomano, L. P., Lee, J. Y., York, S. W., Zheng, H., Mullinnix, M. T., … Ingram, L. O. (2013). Engineering furfural tolerance in Escherichia coli improves the fermentation of lignocellulosic sugars into renewable chemicals. Proceedings of the National Academy of Sciences of the United States of America, 110(10), 4021–4026. http://doi.org/10.1073/pnas.1217958110