Difference between revisions of "Part:BBa K2571003"

Revision as of 12:27, 3 October 2018

FucO L-1,2-propanediol oxidoreductase

L-1,2-propanediol oxidoreductase is an iron-dependent group III dehydrogenase.

FucO is the gene that codes for L-1,2-propanediol oxidoreductase which is a NADH-linked, homodimer enzyme having the role of acting on furfural which is a toxic inhibitor of microbial fermentations causing cell wall and membrane damage, DNA breaks down and reduced enzymatic activities (Zheng, 2013; Liu, Ma & Song, 2009).

The enzyme catalyzes L-lactaldehyde and L-1,2- propanediol while dissimilating fucose in which acetaldehyde, ethylene glycerol, L-lactaldehyde and some more substances are used as substrates. Despite these, it takes an important role in furan reduction to its alcohol derivative (Wang et al. , 2011).

Source

Gene : FucO

Protein : L-1,2-Propanediol Oxidoreductase

Organism : E.coli K12 (MG 1665)

Our circuit design for FucO gene

Our circuit consists of prefix, a strong promoter (J23100), RBS (B0034), FucO as protein coding region, double terminator (B0015) and suffix. This part enables our E. coli KO11 strain to convert toxic furfural into furfuryl alcohol. Our construct is inserted into pSB1C3 and delivered to the Registry.

Circuit design of BBa_K2571003. Our construct includes a strong promoter, RBS, Fuco and double terminator.

In order to make our gene compatible with RFC 10, 25 and 1000, we reconstructed the nucleotides to get rid of the restriction sites while protecting the amino acid sequence. We looked through the codon bias property of E. coli and made the nucleotide changes accordingly.

FucO has NADH-dependent furan reductase activity. When furfural is present in the field, the metabolism of furfural by NADPH-dependent oxidoreductases go active in order to reduce it to its less toxic alcohol derivative-furfuryl alcohol (Zheng, 2013; Wang et al., 2013; Allen et al., 2010).

Effect of FucO overexpression in LY180 (Wang et al. , 2011). The Cell Mass was observed in furfural containing medium. The FucO gene expressing L-1,2-propanediol oxidoreductase reduce the effect of furfural. The specific death rate of normal bacteria is observed to be bigger than the specific death rate of bacteria with FucO gene. Thus FucO shows to increase the tolerance of bacteria and lifespan.

In this metabolism, the expression of oxidoreductases that are NADPH-dependent, such as YqhD, are shown to inhibit the growth and fermentation in E. coli by competing for biosynthesis with NADPH (Zheng, 2013).

The overexpression of FucO and YqhD and relationships with furfural resistance traits, metabolism, and reducing cofactors (Wang et al. , 2013).

Because the native conversion of NADH to NADPH in E. coli is insufficient to revitalize the NADPH pool during fermentation, the actions shouldn’t be interfering with NADPH metabolism (Wang et al. , 2011). Thus, the overexpression of plasmid-based NADH-dependent propanediol oxidoreductase (FucO) gene reduces furfural to ultimately improve furfural resistance without detrimentally affecting the biosynthesis of NADPH (Wang et al., 2011).

3D protein structure of L-1,2-propanediol oxidoreductase, METU_HS_Ankara, 2018

Figure represents the predicted three-dimensional structure of 1,2-propanediol oxidoreductase from E. coli . The protein structure of L-1,2-propanediol oxidoreductase was constructed by using Amber 14. It is demonstrated in the ribbon diagram which is done by interpolating a smooth curve through the polypeptide backbone. The colors indicate the amino acids in the protein structure. While constructing, the codon bias rule is obeyed to express the enzyme in Escherichia Coli KO11.

BBa_K2571003 check with FucO left and VR primers. Expected band length: 625 bp. FucO basic well show positive results.

We’ve inserted the FucO composite part to pSB1C3 and pSB1A3 backbones. Then, we’ve transformed the construct for submission, BBa_K2571003, (in pSB1C3) to DH5 alpha; and the other construct, for our biochemical assay, (in pSB1A3) to KO11. As we isolated the plasmids, we’ve done PCR with FucO left and VR primers to test orientation of our parts to the backbone. We expected a band of 754 bp between the FucO left and VR primers and the PCR results confirmed our expectations and showed that our parts were correctly inserted and transformed.

FucO and VR primers are as below:

FucO left: GTGATAAGGATGCCGGAGAA

VR: ATTACCGCCTTTGAGTGAGC

Sequence and Features