Difference between revisions of "Part:BBa K2281005"
 
(17 intermediate revisions by 3 users not shown)
Line 5: Line 5:
 
===Introduction===
 
===Introduction===
  
−
T7-promoter-F primer: TAATACGACTCACTATAGGG
+
https://static.igem.org/mediawiki/2017/5/5d/T--CIEI-BJ--part--005.jpg
−
T7-terminator-R primer:
+
  
−
Description: When ligated with T7 promoter, lacI operator, RBS and T7 terminator, HbOYE can express properly in E. Coli. The part includes a strong ribosomal binding site. Its strength was determined by cloning it in front of mRFP1 reporter and measuring fluorescence of BL21 cells containing a low copy number plasmid containing the report.
+
LOCUS      NM_001179310   
 +
       
 +
SIZE        1203 bp   
  
−
T7 Promoter primer: a strong primer that can express at any time, any cell under any circumstance, so it motivates the expression of HbOYE.
+
DEFINITION  Saccharomyces cerevisiae S288c NADPH dehydrogenase (OYE2).
−
lacI operator: a lactose opteron consisting promoter and other cis-acting elements. In this part, lacI operator is regulated by T7 promoter. To make lacI operator function, inductor IPTG is added.
+
  
−
HbOYE: 
+
ScOYE stands for Saccharomyces cerevisiae Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.
−
LOCUS DQ004685
+
−
SIZE 1455 bp
+
−
DEFINITION Hevea brasiliensis 12-oxophytodienoate reductase (opr).
+
  
−
===Experiments===
+
[[File:Mosquito_parts-figure1.png|center|940px|img]]
  
−
HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which functions as a reductase. In our experiment, HbOYE bolsters the production of cireonellol from geraniol. Our goal is to combine OYE gene with GES to create an integrated pathway. The pathway will make glucose experience MVA and DXP pathway to be Geranyl diphosphate and then transform into citronellol directly. Therefore, the synthesis of citronellol can be more efficient than ever.
+
The diagram shows the complete pathway of the production of citronellol and OYE is emplyed in the final step of the process.
−
In the experiment, we utilize electrophoresis to check whether the properties of real material is the same as the theoretical one. Only if they are perfectly match, we can perform the latter experiments successfully.
+
  
−
胶图
+
primer:
 +
ScOYE-Ecor1-F:CGGAATTCATGCCATTTGTTAAGG
 +
 +
ScOYE1-R-PstI,ACCTTGCCCTTTTTTGCCGGACTTAATTTTTGTCCCAACCG
  
−
As the picture shown above, the size of the XXX is XXX, so we are one step closer to our success.
+
===Source===
  
−
From Zeng’s research showed that different OYE gene in E.coli and yeast can induce different production of citronellol. Thus, in this part, we choose HbOYE to perform the experiment.
+
SOURCE      Saccharomyces cerevisiae S288C
  
−
In the later step, we are going to construct two plasmids，one contain GES gene, and the other one contain OYE genes, the two plasmids can be transform to one cell. Finally, we will obtain our target product---citronellol.
+
Saccharomyces cerevisiae is a species of yeast. It has been instrumental to winemaking, baking, and brewing since ancient times. It is believed to have been originally isolated from the skin of grapes (one can see the yeast as a component of the thin white film on the skins of some dark-colored fruits such as plums; it exists among the waxes of the cuticle). It is one of the most intensively studied eukaryotic model organisms in molecular and cell biology, much like Escherichia coli as the model bacterium. It is the microorganism behind the most common type of fermentation. S. cerevisiae cells are round to ovoid, 5–10 μm in diameter. It reproduces by a division process known as budding
  
 +
  ORGANISM  Saccharomyces cerevisiae S288C
 +
            Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
 +
            Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
 +
            Saccharomyces.
  
−
===Referrence===
+
https://static.igem.org/mediawiki/2017/5/55/T--CIEI-BJ--Parts--1.jpg
−
Ying ZENG et al. ‘Identification of enzymes responsible for the reduction of geraniol to Citronellol’. DOI 10.1007/s13659-011-0032-6
+
  
−
Gareth Norton et al.. ‘Characterisation of recombinant Hevea brasiliensis allene oxide synthase: Effects of cycloxygenase inhibitors, lipoxygenase inhibitors and salicylates on enzyme activity’. Plant Physiology and Biochemistry 45 (2007) 129-138.
 
  
−
Zeng Ying et al. ‘Identification of Enzymes Responsible for the Reduction of Geraniol to Citronellol’. Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, 650201
+
===References===
 +
 
 +
REFERENCE  1  (bases 1 to 1203)
 +
  AUTHORS  Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
 +
            Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
 +
            Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
 +
            Oliver,S.G.
 +
  TITLE    Life with 6000 genes
 +
  JOURNAL  Science 274 (5287), 546 (1996)
 +
  PUBMED  8849441
 +
 
 +
REFERENCE  2  (bases 1 to 1203)
 +
  AUTHORS  Johnston,M., Andrews,S., Brinkman,R., Cooper,J., Ding,H., Dover,J.,
 +
            Du,Z., Favello,A., Fulton,L., Gattung,S. et al.
 +
  TITLE    Complete nucleotide sequence of Saccharomyces cerevisiae chromosome
 +
            VIII
 +
  JOURNAL  Science 265 (5181), 2077-2082 (1994)
 +
  PUBMED  8091229
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Latest revision as of 04:01, 2 November 2017


--ScOYE--

Introduction

T--CIEI-BJ--part--005.jpg

LOCUS NM_001179310

SIZE 1203 bp

DEFINITION Saccharomyces cerevisiae S288c NADPH dehydrogenase (OYE2).

ScOYE stands for Saccharomyces cerevisiae Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.

img

The diagram shows the complete pathway of the production of citronellol and OYE is emplyed in the final step of the process.

primer: ScOYE-Ecor1-F:CGGAATTCATGCCATTTGTTAAGG

ScOYE1-R-PstI,ACCTTGCCCTTTTTTGCCGGACTTAATTTTTGTCCCAACCG

Source

SOURCE Saccharomyces cerevisiae S288C

Saccharomyces cerevisiae is a species of yeast. It has been instrumental to winemaking, baking, and brewing since ancient times. It is believed to have been originally isolated from the skin of grapes (one can see the yeast as a component of the thin white film on the skins of some dark-colored fruits such as plums; it exists among the waxes of the cuticle). It is one of the most intensively studied eukaryotic model organisms in molecular and cell biology, much like Escherichia coli as the model bacterium. It is the microorganism behind the most common type of fermentation. S. cerevisiae cells are round to ovoid, 5–10 μm in diameter. It reproduces by a division process known as budding 

 ORGANISM  Saccharomyces cerevisiae S288C
           Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
           Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
           Saccharomyces.

T--CIEI-BJ--Parts--1.jpg


References

REFERENCE 1 (bases 1 to 1203) 

 AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
           Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
           Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
           Oliver,S.G.
 TITLE     Life with 6000 genes
 JOURNAL   Science 274 (5287), 546 (1996)
  PUBMED   8849441

REFERENCE 2 (bases 1 to 1203) 

 AUTHORS   Johnston,M., Andrews,S., Brinkman,R., Cooper,J., Ding,H., Dover,J.,
           Du,Z., Favello,A., Fulton,L., Gattung,S. et al.
 TITLE     Complete nucleotide sequence of Saccharomyces cerevisiae chromosome
           VIII
 JOURNAL   Science 265 (5181), 2077-2082 (1994)
  PUBMED   8091229

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 646
    Illegal BamHI site found at 1017
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 778
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 824