Difference between revisions of "Part:BBa K2273111"

Latest revision as of 03:46, 2 November 2017

P_blaZ Promoter controlling gene expression of blaZ in S. aureus

The P_blaZ promoter is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].

This part is a composite of the bla operon found in Staphylococcus aureus and constitutes the promoter regulating gene expression of the gene blaZ, coding for a beta-lactamase. If the microorganism is exposed to beta-lactam antibiotics, a receptor, named blaR1 [1], senses the compound and a signal is transduced into the cytoplasm. Subsequently, the BlaI repressor protein [2] is degraded and frees the P_blaZ promoter. Following, the blaZ gene is transcribed and confers resistance to the antibiotic.

This part features the RFC10 prefix and suffix:

Prefix with	EcoRI, NotI, XbaI	GAATTCGCGGCCGCTTCTAGA
Suffix with	SpeI, NotI and PstI	ACTAGTAGCGGCCGCTGCAGA

Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red)

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

Beta-Lactam Biosensor

Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor Beta-lactam biosensor] in Bacillus subtilis. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to prove the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.

Design of the Biosensor

To achieve our goal of encapsulating bacteria into Peptidosomes that can sense antibiotics of the beta-lactam family, we first needed to develop a reliable biosensor strain. In Staphylococcus aureus the bla-operon encodes a one-component system, which is responsible for sensing and mediating resistance against beta-lactam antibiotics. The idea was to transfer the regulatory elements of this operon to Bacillus subtilis and replace the native output – being the beta-lactamase BlaZ – by an easy detectable signal. Thus, making Bacillus subtilis a Beta-lactam sensing biosensor. (see Figure 1).

Figure 1: Overall concept showing the components and the molecular mechanism of the biosensor in **B. subtilis**.Upon binding of a beta-lactam to the receptor BlaR1 **(1)**, due to the receptors c-terminal proteolytic activity, the repressor BlaI is degraded and frees the target promoter **(2)** enabling the expression of an easy detectable reporter **(3)**.

For the creation of our biosensor in B. subtilis, the bla-operon from S. aureus was split into three genetic constructs: (A) The Receptor gene blaR1 under control of a strong constitutive promotor (P_veg), (B) the Repressor gene blaI under control moderate strong constitutive promoter (P_lepA) and the target promoter P_blaZ in front of the lux-operon (luxABCDE). In addition, an inducible version of the blaR1 construct was made by inserting the P_xylA promoter upstream of the blaR1 gene. [1
The following results demonstrate the promoter activity of P_blaZ in the context of our biosensor. We could observe, that this promoter is very sensitive and strong. These findings are supported by the data below:

Evaluation of the promoter activity in the context of the biosensor

During this project, we generated several strains to investigate the functionality of the heterologous constructs constituting the biosensor in Bacillus subtilis. This result section though will focus on the evaluation of the strains shown in Table 2 as these represent the most interesting ones.

**Table 1: Antibiotic concentrations in [µg µl^-1] (final concentration in the well) used in all further plate reader experiments.**

In our first experiment, we performed plate reader assays in a 96 well plate format and measured growth (OD₆₀₀) and luminescence output for 18 hours every 5 minutes. Induction with the Beta-lactam antibiotics occurred after 1 hour. All strains have been tested in triplicates under the same conditions. Strains with the genotype penP::kan^R have been induced with lower concentrations compared to the wild type strain W168 (see Table 1 above).
After induction, we anticipate a strong increase in luminescence signal for the biosensor strains. The control strain W168 (wild type) and control 1, will presumably not show any luminescence output, while the positive control 2 is expected to show a steady luminescence signal regardless of the presence of any antibiotic compound.

**Table 2: Strains of interest with their names and important genotype remarks for differentiation.**

As shown in Figure 2, the wildtype W168 (black with white dots) shows no increase in RLU/OD₆₀₀ values when induced with the different Beta-lactam antibiotics and controls. Control 1 (black tight stripes) behaves similarly to the wild type strain. The slight decrease of control 2 (light grey) in the bar chart where induction with ampicillin and carbenicillin happened, is mostly explained by the high growth inhibition caused by the chosen concentrations for W168 (with functional Beta-lactamase PenP). Most of the times, the constitutive expression of the lux operon resulted in an RLU/OD₆₀₀ of over 1.3 million for control 2 (see Figure 2).

**Figure 2: RLU/OD₆₀₀ values of the different biosensors and the controls are shown 2 hours after induction with the six beta-lactams, bacitracin and dH₂O**. Graphs show the Wild-type (**black**), control 1 (**light gray**), control 2 (**dark gray**), biosensor 1 (**pink**), biosensor 2 (**purple**), biosensor 3 (**white and black**) and biosensor 3 Xylose induced (**dark blue**). Luminescence (RLU/OD₆₀₀) output is shown two hours after beta-lactam antibiotic induction. Mean values and standard deviation are depicted from at least three biological replicates.

Biosensor 1 gives an overall good signal for all Beta-lactam antibiotics tested, but also shows a higher basal activity in absence of the Beta-lactam compounds of 40.000- 90.000 RLU/OD₆₀₀ (see Figure 2, bar chart with bacitracin and dH₂O). Further, we could observe a difference in signal intensity dependent on the Beta-lactam antibiotic tested. Therefore, biosensor 1 gives the highest signal in presence of penicillin G, cefoxitin and cefoperazone with up to 2.7 million RLU/OD₆₀₀. Ampicillin and penicillin G again show a weaker increase in signal produced by biosensor 1, which could be due to the same reason as for control 2 (see Figure 2).
For biosensor 2, the detection range and sensitivity is comparable to biosensor 1, This strain strongly senses cefoxitin, ampicillin and cefoperazone reaching up to 2.4 million RLU/OD₆₀₀. Even the basal activity of the P_blaZ promoter in biosensor 2, as shown in the bar charts with bacitracin and dH₂O, conforms with the one from biosensor 1.
Additionally, we evaluated the biosensors activity on solid MH-medium. Therefore we carried out disk diffusion assays (see Figure3) and tested the concentrations listed in Table 3.

**Table 3: Antibiotic concentrations in [µg µl^-1] used in the disk diffusion assays.**

**Figure 3: Photographs of the plates from the disk diffusion assay.** The upper rows (Panel A and C) show pictures of the plates with the strains under daylight conditions, while the row beneath (Panel B and D) shows the plate after detection of chemiluminescence (2 minutes exposure time). At the bottom in Panel E, the disk layout and the most important remarks of the genotype of all strains are indicated.

We expected the control substances (water and bacitracin) to not cause any luminescence signal at the edge of the inhibition zones. The β-lactam antibiotics should lead to a glowing halo when tested with the three different biosensor versions. The wildtype strain and control 1 should not show any signal, since both strains are lacking the lux operon. In the case of control 2 a luminescence signal should be spread over the whole plate, due to the constitutive expression (P_veg) of luciferase. Figure 3 sums up the results of the disk diffusion assay for all strains tested. After 24 hours of incubation at 37°C, plates were photographed under day light conditions and under a chemiluminescence dock (with two minutes exposure time).
As expected, the wildtype and control 1, show no luminescence signal, while control 2 leads to a strong luminescence signal spread across the entire plate (Figure 3, Panel B). Neither bacitracin, nor dH₂O lead to an detectable output, accounting for all strains tested. While in liquid medium biosensor 1 behaves similar compared to biosensor 2, there is a tremendous difference in the detection capability. Biosensor 2 showed detection for all β-lactams tested (Figure 3, Panel D). Au contraire, biosensor 1 only showed a luminescence signal for cefoperazone, cefoxitin and cefalexin (Figure 3, Panel D). Further, the luminescence halo around the cefoxitin disk is quite broad compared to the others, indicating an increased diffusion of the compound into the lawn. Although, biosensor 1 was activated by penicillin G in liquid medium, we could not observe an induction on plate (Figure 3, Panel D).
Biosensor 2 was activated by all of the β-lactam compounds tested (Figure 3, Panel D). Ampicillin, cefoxitin, cefalexin and cefoperazone strongly activate the system, while penicillin G and carbenicillin just show a weak induction of the signal on plate. These findings go along with the results obtained in liquid medium in the previous experiments. On the plate with the lawn of biosensor 3 (Panel D), all β-lactams could be detected efficiently when 0.2% xylose was added. In contrast to biosensor 1 and 2, there is a very weak luminescence halo around the cefalexin disk. Also, this halo seems not to de directly at the edge where the cells are in contact with the antibiotic, but rather a bit further off the inhibition zone. Without induction of biosensor 3 with 0.2% xylose, we could not detect any luminescence signal, demonstrating that the receptor (BlaR1) is crucial for detection and signal transduction, standing in line with results obtained in liquid medium (data not shown).

Assessing the biosensors activity in Peptidosomes

After evaluation of the biosensor we probed its activity when encapsulated in [http://2017.igem.org/Team:TU_Dresden/Project/Peptidosomes Peptidosomes] - a novel peptide-based matrix to encase bacteria. An overnight culture was inoculated in FmocFF-Solution with a final OD₆₀₀=10. Peptidosomes were prepare containing no bacteria (A), W168 (B), Control 2 (C) and Biosensor 2 (D) (see Figure 4 below) and underwent 3 washing steps. Afterwards, the Peptidosomes were transferred to a 12-well plate, incubated at 37˚C and luminescence was detected every hour. Induction with 0.2µg µl^-1 cefoperazone happened after 1 hour of growth.
The Peptidosomes without cells and the wild type W168 are expected to show no luminescence signal at all times (A and B). We estimate control 2 to reach a luminescence signal under non-induced as well as under induced conditions (C). This signal should be weaker than that of the induced biosensor 2 (D, +AB). No signal is expected for the encapsulated biosensor in absence of cefoperazone (D, -AB).

In this experiment, we successfully encapsulated biosensor 2 into Peptidosomes and demonstrated its ability to sense the β-lactam cefoperazone diffusing into the Peptidosome. Already 2 hours post induction, there is a luminescence signal detectable for control 2 and the encapsulated biosensor 2 (see Figure 4, middle, C and D). Four hours post induction, we could observe an increase in luminescence signal for biosensor 2 in the Peptidosomes (see Figure 4, right, D). The non-induced sample of control 2 shows a breakage of the Peptidosome and thus a spreading of the luminescent bacteria in the well after four hours (Figure 4, right, C).

**Figure 4: Encapsulation experiment with biosensor 2.** The pictures in the upper row show the distribution of the Peptidosomes at the time point of luminescence detection, which was immediately performed afterwards using a chemiluminescence dock (bottom row). Pink arrows indicate Peptidosomes with a luminescence signal deriving from the encapsulated biosensor. Upper row of well plates contain non-induced samples. Lower row of well plates were induced with cefoperazone (0.2µg µl^-1).

Conclusion

From these findings we can conclude, that the P_blaZ promoter gives a high luminescence output when the one component system is activated by different beta-lactam antibiotics. This allows for an easy differentiation between background and a real detection signal. The luminescence output could be measured well in liquid medium (MH-Medium) and on solid medium (MH-Agar), as well as in Peptidosomes, therefore showing high reproducibility of the results.

References:

1 C. Lee Ventola, MS (2015) The antibiotic resistance crisis: part 2: management strategies and new agents. Pharmacy and Therapeutics 40(5), 344–352 2 www.aerzteblatt.de, visited 08/23/17 (5:34pm) [http://www.who.int/mediacentre/factsheets/fs194/en/ 3] www.who.int, visited 09/04/17 (3:21pm) 4 https://en.wikipedia.org/wiki/Β-lactam_antibiotic, visited 10/27/17 (4:42pm) 5 Leticia I. Llarrull, Mary Prorok, and Shahriar Mobashery (2010) Binding of the Gene Repressor BlaI to the bla Operon in Methicillin-Resistant Staphylococcus aureus. Biochemistry 49(37), 7975–7977 Radeck, J., Kraft, K., Bartels, J., Cikovic, T., Dürr, F., Emenegger, J., Kelterborn, S., Sauer, C., Fritz, G., Gebhard, S., and Mascher, T. (2013) 6 The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. J Biol Eng 7(29),7 Toth, M., Antunes, N.T., Stewart, N.K., Frase, H., Bhattacharya, M., Smith, C. and Vakulenko, S. (2016) Class D β-lactamases do exist in Gram-positive bacteria. Nature Chemical Biology 12(1),9-14

@@ Line 27: / Line 27: @@
 ===Beta-Lactam Biosensor===
-<p>Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous Beta-lactam biosensor in <i>Bacillus subtilis</i>. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.</p>
+Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor Beta-lactam biosensor] in <i>Bacillus subtilis</i>. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to prove the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.<br>
 ===Design of the Biosensor===
-<p>To achieve our goal of encapsulating bacteria into Peptidosomes that can sense antibiotics of the beta-lactam family, we first needed to develop a reliable biosensor strain.
+To achieve our goal of encapsulating bacteria into Peptidosomes that can sense antibiotics of the beta-lactam family, we first needed to develop a reliable biosensor strain.
-In <i>Staphylococcus aureus</i> the <i>bla</i>-operon encodes a one-component system, which is responsible for sensing and mediating resistance against beta-lactam antibiotics. The idea was to transfer the regulatory elements of this operon to <i>Bacillus subtilis</i> and replace the native output – being the beta-lactamase <i>BlaZ</i> – by an easy detectable signal. Thus, making <i>Bacillus subtilis</i> a beta-lactam sensing biosensor. (see Figure 2).</p>
+In <i>Staphylococcus aureus</i> the <i>bla</i>-operon encodes a one-component system, which is responsible for sensing and mediating resistance against beta-lactam antibiotics. The idea was to transfer the regulatory elements of this operon to <i>Bacillus subtilis</i> and replace the native output – being the beta-lactamase <i>BlaZ</i> – by an easy detectable signal. Thus, making <i>Bacillus subtilis</i> a Beta-lactam sensing biosensor. (see Figure 1).<br>
 <html>
 <figure>
-    <figure style="width:70%;float:left;">
+    <figure style="width:90%;">
-       <img src="https://static.igem.org/mediawiki/2017/4/46/T--TU_Dresden--P_Biosensor_Figure2_mechanismbiosensor.png"width="70%">
+       <img src="https://static.igem.org/mediawiki/2017/4/46/T--TU_Dresden--P_Biosensor_Figure2_mechanismbiosensor.png"width="100%">
-      <figcaption><b>Figure 2: Overall concept showing the components and the molecular mechanism of the biosensor in <i><b>B. subtilis</b></i></b>.Upon binding of a beta-lactam to the receptor BlaR1 <b>(1)</b>, due to the receptors c-terminal proteolytic activity, the repressor BlaI is degraded and frees the target promoter <b>(2)</b> enabling the expression of an easy detectable reporter <b>(3)</b>.
+      <figcaption><b>Figure 1: Overall concept showing the components and the molecular mechanism of the biosensor in <i><b>B. subtilis</b></i></b>.Upon binding of a beta-lactam to the receptor BlaR1 <b>(1)</b>, due to the receptors c-terminal proteolytic activity, the repressor BlaI is degraded and frees the target promoter <b>(2)</b> enabling the expression of an easy detectable reporter <b>(3)</b>.
 </figcaption>
      </figure>
+</figure>
 </html>
-<p></p>
+<br>
-<p>For the creation of our biosensor in <i>B. subtilis</i>, the <i>bla</i>-operon from <i>S. aureus</i> was split into three genetic constructs: <b>(A)</b> The Receptor gene <i>blaR1</i> under control of a strong constitutive promotor (P<sub><i>veg</i></sub>), <b>(B)</b> the Repressor gene blaI under control moderate strong constitutive promoter (P<sub><i>lepA</i></sub>) and <b>(C)</b> the target promoter region of the <i>bla</i>-operon (P<sub><i>blaZ</i></sub> and P<sub><i>blaR1I</i></sub>) in front of the <i>lux</i>-operon (<i>luxABCDE</i>). In addition, an inducible version of the <i>blaR1</i> construct was made by inserting the P<sub><i>xylA</i></sub> promoter upstream of the <i>blaR1</i> gene <b>(A)</b>.<a target="_blank" href ="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2942778/">[5]</a></p>
+For the creation of our biosensor in <i>B. subtilis</i>, the <i>bla</i>-operon from <i>S. aureus</i> was split into three genetic constructs: <b>(A)</b> The Receptor gene <i>blaR1</i> under control of a strong constitutive promotor (P<sub><i>veg</i></sub>), <b>(B)</b> the Repressor gene <i>blaI</i> under control moderate strong constitutive promoter (P<sub><i>lepA</i></sub>) and the target promoter P<sub><i>blaZ</i></sub> in front of the <i>lux</i>-operon (<i>luxABCDE</i>). In addition, an inducible version of the <i>blaR1</i> construct was made by inserting the P<sub><i>xylA</i></sub> promoter upstream of the <i>blaR1</i> gene.  [https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2942778 [1]<br>
+The following results demonstrate the promoter activity of P<sub><i>blaZ</i></sub> in the context of our biosensor. We could observe, that this promoter is very sensitive and strong. These findings are supported by the data below:<br>
-===Functional Parameters===
+===Evaluation of the promoter activity in the context of the biosensor===
-<partinfo>BBa_K2273111 parameters</partinfo>
+During this project, we generated several strains to investigate the functionality of the heterologous constructs constituting the biosensor in <i>Bacillus subtilis</i>. This result section though will focus on the evaluation of the strains shown in Table 2 as these represent the most interesting ones.<br>
-<!-- -->
+<html>
+<center><figure style="width:49%;">
+<figcaption><b>Table 1: Antibiotic concentrations in [&#181;g &#181;l<sup>-1</sup>] (final concentration in the well) used in all further plate reader experiments.
+</b></figcaption>
+      <img src="https://static.igem.org/mediawiki/2017/a/ac/T--TU_Dresden--P_Biosensor_Table4_finalconcentrations_correct.png"width="90%">
+</figure></center>
+<br>
+In our first experiment, we performed plate reader assays in a 96 well plate format and measured growth (OD<sub>600</sub>) and luminescence output for 18 hours every 5 minutes. Induction with the Beta-lactam antibiotics occurred after 1 hour. All strains have been tested in triplicates under the same conditions. Strains with the genotype <i>penP::kan<sup>R</sup></i> have been induced with lower concentrations compared to the wild type strain W168 (see Table 1 above).<br>
+After induction, we anticipate a strong increase in luminescence signal for the biosensor strains. The control strain W168 (wild type) and control 1, will presumably not show any luminescence output, while the positive control 2 is expected to show a steady luminescence signal regardless of the presence of any antibiotic compound.
+<br>
+<html>
+<figure style="width:90%;">
+<figcaption><b>Table 2: Strains of interest with their names and important genotype remarks for differentiation.</b></figcaption>
+      <img src="https://static.igem.org/mediawiki/2017/f/f6/T--TU_Dresden--P_Biosensor_Table5_genotypeBiosensors.png"width="100%">
+</figure>
+</html>
+As shown in Figure 2, the wildtype W168 (black with white dots) shows no increase in RLU/OD<sub>600</sub> values when induced with the different Beta-lactam antibiotics and controls. Control 1 (black tight stripes) behaves similarly to the wild type strain. The slight decrease of control 2 (light grey) in the bar chart where induction with ampicillin and carbenicillin happened, is mostly explained by the high growth inhibition caused by the chosen concentrations for W168 (with functional Beta-lactamase PenP). Most of the times, the constitutive expression of the <i>lux</i> operon resulted in an RLU/OD<sub>600</sub> of over 1.3 million for control 2 (see Figure 2).<br>
+<html>
+<figure>
+<figure style="width:90%;">
+      <img src="https://static.igem.org/mediawiki/2017/a/ab/T--TU_Dresden--P_Biosensor_Figure5.png"width="90%">
+     <figcaption><b>Figure 2: RLU/OD<sub>600</sub> values of the different biosensors and the controls are shown 2 hours after induction with the six beta-lactams, bacitracin and dH<sub><b>2</b></sub>O</b>. Graphs show the Wild-type (<b>black</b>), control 1 (<b>light gray</b>), control 2 (<b>dark gray</b>), biosensor 1 (<b>pink</b>), biosensor 2 (<b>purple</b>), biosensor 3 (<b>white and black</b>) and biosensor 3 Xylose induced (<b>dark blue</b>). Luminescence (RLU/OD<sub>600</sub>) output is shown two hours after beta-lactam antibiotic induction. Mean values and standard deviation are depicted from at least three biological replicates.
+</figcaption></figure> </figure>
+<br>
+Biosensor 1 gives an overall good signal for all Beta-lactam antibiotics tested, but also shows a higher basal activity in absence of the Beta-lactam compounds of 40.000- 90.000 RLU/OD<sub>600</sub> (see Figure 2, bar chart with bacitracin and dH<sub>2</sub>O). Further, we could observe a difference in signal intensity dependent on the Beta-lactam antibiotic tested.  Therefore, biosensor 1 gives the highest signal in presence of penicillin G, cefoxitin and cefoperazone with up to 2.7 million RLU/OD<sub>600</sub>. Ampicillin and penicillin G again show a weaker increase in signal produced by biosensor 1, which could be due to the same reason as for control 2 (see Figure 2).<br>
+For biosensor 2, the detection range and sensitivity is comparable to biosensor 1, This strain strongly senses cefoxitin, ampicillin and cefoperazone reaching up to 2.4 million RLU/OD<sub>600</sub>. Even the basal activity of the P<sub><i>blaZ</i></sub> promoter in biosensor 2, as shown in the bar charts with bacitracin and dH<sub>2</sub>O, conforms with the one from biosensor 1.<br>
+Additionally, we evaluated the biosensors activity on solid MH-medium. Therefore we carried out disk diffusion assays (see Figure3) and tested the concentrations listed in Table 3.
+<html>
+<center><figure style="width:49%;">
+<figcaption><b>Table 3: Antibiotic concentrations in [&#181;g &#181;l<sup>-1</sup>] used in the disk diffusion assays.
+</b></figcaption>
+      <img src="https://static.igem.org/mediawiki/2017/b/b0/T--TU_Dresden--P_Biosensor_Table6.png"width="90%">
+</figure></center>
+<br>
+<br>
+</html>
+<html>
+ <figure style="width:90%;">
+      <img src="https://static.igem.org/mediawiki/2017/d/d5/T--TU_Dresden--P_Biosensor_Figure7.png"width="90%">
+<figcaption><b>Figure 3: Photographs of the plates from the disk diffusion assay. </b>The upper rows (Panel A and C) show pictures of the plates with the strains under daylight conditions, while the row beneath (Panel B and D) shows the plate after detection of chemiluminescence (2 minutes exposure time). At the bottom in Panel E, the disk layout and the most important remarks of the genotype of all strains are indicated.
+</figcaption>
+</figure>
+</html>
+<br>
+We expected the control substances (water and bacitracin) to not cause any luminescence signal at the edge of the inhibition zones. The &#946;-lactam antibiotics should lead to a glowing halo when tested with the three different biosensor versions. The wildtype strain and control 1 should not show any signal, since both strains are lacking the <i>lux</i> operon. In the case of control 2 a luminescence signal should be spread over the whole plate, due to the constitutive expression (P<sub><i>veg</i></sub>) of luciferase. Figure 3 sums up the results of the disk diffusion assay for all strains tested. After 24 hours of incubation at 37°C, plates were photographed under day light conditions and under a chemiluminescence dock (with two minutes exposure time).<br>
+As expected, the wildtype and control 1, show no luminescence signal, while control 2 leads to a strong luminescence signal spread across the entire plate (Figure 3, Panel B). Neither bacitracin, nor dH<sub>2</sub>O lead to an detectable output, accounting for all strains tested. While in liquid medium biosensor 1 behaves similar compared to biosensor 2, there is a tremendous difference in the detection capability. Biosensor 2 showed detection for all &#946;-lactams tested (Figure 3, Panel D). Au contraire, biosensor 1 only showed a luminescence signal for cefoperazone, cefoxitin and cefalexin (Figure 3, Panel D). Further, the luminescence halo around the cefoxitin disk is quite broad compared to the others, indicating an increased diffusion of the compound into the lawn. Although, biosensor 1 was activated by penicillin G in liquid medium, we could not observe an induction on plate (Figure 3, Panel D).<br>
+Biosensor 2 was activated by all of the &#946;-lactam compounds tested (Figure 3, Panel D). Ampicillin, cefoxitin, cefalexin and cefoperazone strongly activate the system, while penicillin G and carbenicillin just show a weak induction of the signal on plate. These findings go along with the results obtained in liquid medium in the previous experiments.
+On the plate with the lawn of biosensor 3 (Panel D), all &#946;-lactams could be detected efficiently when 0.2% xylose was added. In contrast to biosensor 1 and 2, there is a very weak luminescence halo around the cefalexin disk. Also, this halo seems not to de directly at the edge where the cells are in contact with the antibiotic, but rather a bit further off the inhibition zone. Without induction of biosensor 3 with 0.2% xylose, we could not detect any luminescence signal, demonstrating that the receptor (BlaR1) is crucial for detection and signal transduction, standing in line with results obtained in liquid medium (data not shown).<br>
+<br>
+===Assessing the biosensors activity in Peptidosomes===
+After evaluation of the biosensor we probed its activity when encapsulated in [http://2017.igem.org/Team:TU_Dresden/Project/Peptidosomes Peptidosomes] - a novel peptide-based matrix to encase bacteria. An overnight culture was inoculated in FmocFF-Solution with a final OD<sub>600</sub>=10. Peptidosomes were prepare containing no bacteria (A), W168 (B), Control 2 (C) and Biosensor 2 (D) (see Figure 4 below) and underwent 3 washing steps. Afterwards, the Peptidosomes were transferred to a 12-well plate, incubated at 37˚C and luminescence was detected every hour. Induction with 0.2&#181;g &#181;l<sup>-1</sup> cefoperazone happened after 1 hour of growth.<br>
+The Peptidosomes without cells and the wild type W168 are expected to show no luminescence signal at all times (A and B). We estimate control 2 to reach a luminescence signal under non-induced as well as under induced conditions (C). This signal should be weaker than that of the induced biosensor 2 (D, +AB). No signal is expected for the encapsulated biosensor in absence of cefoperazone (D, -AB).<br>
+<br>
+In this experiment, we successfully encapsulated biosensor 2 into Peptidosomes and demonstrated its ability to sense the &#946;-lactam cefoperazone diffusing into the Peptidosome.  Already 2 hours post induction, there is a luminescence signal detectable for control 2 and the encapsulated biosensor 2 (see Figure 4, middle, C and D). Four hours post induction, we could observe an increase in luminescence signal for biosensor 2 in the Peptidosomes (see Figure 4, right, D). The non-induced sample of control 2 shows a breakage of the Peptidosome and thus a spreading of the luminescent bacteria in the well after four hours (Figure 4, right, C).<br>
+<br>
+<html>
+ <figure style="width:90%;">
+      <img src="https://static.igem.org/mediawiki/2017/9/90/T--TU_Dresden--P_Biosensor_Figure10.png"width="90%">
+<figcaption><b>Figure 4: Encapsulation experiment with biosensor 2.</b> The pictures in the upper row show the distribution of the Peptidosomes at the time point of luminescence detection, which was immediately performed afterwards using a chemiluminescence dock (bottom row). Pink arrows indicate Peptidosomes with a luminescence signal deriving from the encapsulated biosensor. Upper row of well plates contain non-induced samples. Lower row of well plates were induced with cefoperazone (0.2&#181;g &#181;l<sup>-1</sup>).
+</figcaption>
+</figure>
+</html>
+===Conclusion===
+From these findings we can conclude, that the P<sub><i>blaZ</i></sub> promoter gives a high luminescence output when the one component system is activated by different beta-lactam antibiotics. This allows for an easy differentiation between background and a real detection signal. The luminescence output could be measured well in liquid medium (MH-Medium) and on solid medium (MH-Agar), as well as in Peptidosomes, therefore showing high reproducibility of the results.
+References:
+[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4422635/ 1] C. Lee Ventola, MS (2015) The antibiotic resistance crisis: part 2: management strategies and new agents. Pharmacy and Therapeutics 40(5), 344–352
+[https://www.aerzteblatt.de/archiv/52563 2] www.aerzteblatt.de, visited 08/23/17 (5:34pm)
+[http://www.who.int/mediacentre/factsheets/fs194/en/ 3] www.who.int, visited 09/04/17 (3:21pm)
+[https://en.wikipedia.org/wiki/Β-lactam_antibiotic 4] https://en.wikipedia.org/wiki/Β-lactam_antibiotic, visited 10/27/17 (4:42pm)
+[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2942778/ 5] Leticia I. Llarrull, Mary Prorok, and Shahriar Mobashery (2010) Binding of the Gene Repressor BlaI to the bla Operon in Methicillin-Resistant Staphylococcus aureus. Biochemistry 49(37), 7975–7977 Radeck, J., Kraft, K., Bartels, J., Cikovic, T., Dürr, F., Emenegger, J., Kelterborn, S., Sauer, C., Fritz, G., Gebhard, S., and Mascher, T. (2013)
+[https://jbioleng.biomedcentral.com/articles/10.1186/1754-1611-7-29 6] The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis. J Biol Eng 7(29),[https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4684797/ 7] Toth, M., Antunes, N.T., Stewart, N.K., Frase, H., Bhattacharya, M., Smith, C. and Vakulenko, S. (2016) Class D β-lactamases do exist in Gram-positive bacteria. Nature Chemical Biology 12(1),9-14