Difference between revisions of "Part:BBa K2340000"
 
(9 intermediate revisions by the same user not shown)
Line 4: Line 4:
  
  
−
 
−
<!-- Add more about the biology of this part here
 
−
===Usage and Biology===
 
−
 
−
'dead' CAS13a with a double HEPN nuclease 1 and 2 inactive mutation, linked to a green fluorescent protein (wtGFP) via a linker sequence (ggctcctccggc). On both ends of the construct there are nuclear localization sequences (NLS; cccaagaaaaaacgcaaggtg) that will reduce background noise when expressed and used in mammalian cell lines.
 
  
 
<!-- -->
 
<!-- -->
−
<span class='h3bb'>Sequence and Features</span>
+
<span class='h3bb'><font size="+1"><b> Sequence and Features</b></font></span>
 
<partinfo>BBa_K2340000 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K2340000 SequenceAndFeatures</partinfo>
  
 +
 +
<b><font size="+1"> Usage and Biology </font></b>
 +
 +
dead CAS13a (or dCas13) with a double HEPN nuclease 1 and 2 inactive mutation, linked to a green fluorescent protein (wtGFP) via a linker sequence (ggctcctccggc). On the N-terminal and the C-terminal of the construct there are nuclear localization sequences (NLS; DNA sequence: cccaagaaaaaacgcaaggtg. Amino acid sequence: PKKKRKV) that will reduce background noise when expressed and used in mammalian cell lines.
 +
 +
When supplied with a guide RNA (gRNA), this enzyme will process it into a CRISPR RNA (crRNA). The crRNA contains a sequence that is complementary to the RNA it is targetting.
 +
 +
 +
<b><font size="+0.75"> Validation </font></b>
 +
 +
The part was validated with two screening primers 200bp up- and downstream of insert and then seperated on a 1% agarose gel using electrophoresis.
 +
[[File:Team kent DCAS13a-GFP-AGE.jpeg|600px|thumb|left|Figure 1: Agarose gel of a screening PCR of BBa_K2340000 in pSB1C3. We used two primer approximately 200bp up- and downstream of our insert]]
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  

Latest revision as of 03:41, 2 November 2017


dCAS13a linked to GFP with NLS


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1112
    Illegal BglII site found at 2048
    Illegal BglII site found at 2312
    Illegal BglII site found at 2816
    Illegal BglII site found at 3302
    Illegal BglII site found at 3410
    Illegal BglII site found at 3740
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 662
    Illegal SapI.rc site found at 3421


Usage and Biology

dead CAS13a (or dCas13) with a double HEPN nuclease 1 and 2 inactive mutation, linked to a green fluorescent protein (wtGFP) via a linker sequence (ggctcctccggc). On the N-terminal and the C-terminal of the construct there are nuclear localization sequences (NLS; DNA sequence: cccaagaaaaaacgcaaggtg. Amino acid sequence: PKKKRKV) that will reduce background noise when expressed and used in mammalian cell lines.

When supplied with a guide RNA (gRNA), this enzyme will process it into a CRISPR RNA (crRNA). The crRNA contains a sequence that is complementary to the RNA it is targetting.


Validation

The part was validated with two screening primers 200bp up- and downstream of insert and then seperated on a 1% agarose gel using electrophoresis.

Figure 1: Agarose gel of a screening PCR of BBa_K2340000 in pSB1C3. We used two primer approximately 200bp up- and downstream of our insert