Difference between revisions of "Part:BBa K1928001"
Awesome Zz (Talk | contribs) |
|||
Line 5: | Line 5: | ||
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(CTAGTTGGGCGAGTTACGGACCTCTAAACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 1b RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 1b. | Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(CTAGTTGGGCGAGTTACGGACCTCTAAACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 1b RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 1b. | ||
+ | <br> | ||
+ | <strong>Contribution</strong> | ||
+ | <br> | ||
+ | Group: Shenzhen_SFLS | ||
+ | <br> | ||
+ | Author: Mixiao Gui | ||
+ | <br> | ||
+ | Summary: We have submitted this part. | ||
+ | <br> | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here |
Revision as of 01:08, 2 November 2017
toehold switch sensor to detect HCV 1b RNA
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(CTAGTTGGGCGAGTTACGGACCTCTAAACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 1b RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 1b.
Contribution
Group: Shenzhen_SFLS
Author: Mixiao Gui
Summary: We have submitted this part.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Unknown
- 21INCOMPATIBLE WITH RFC[21]Unknown
- 23INCOMPATIBLE WITH RFC[23]Unknown
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Unknown