Difference between revisions of "Part:BBa K2194004:Design"
Catdunaway (Talk | contribs) (→Design Notes) |
|||
(16 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
+ | __NOTOC__ | ||
+ | <partinfo>BBa_K2194004 short</partinfo> | ||
+ | |||
+ | <partinfo>BBa_K2194004 SequenceAndFeatures</partinfo> | ||
+ | |||
+ | |||
+ | ===Design Notes=== | ||
+ | The RBS before <i>cysPUWA</i> was designed using the Salis Lab RBS Designer [1]. The pre-sequence used was the <i>PgntK</i> promoter sequence, and the protein-coding sequence used was the <i>cysP</i> sequence. This particular RBS was chosen (see Figure 1 below) because it had the highest translation rate. | ||
+ | |||
+ | [[File:RBS_for_BBa_K2194004.png|600px]] | ||
+ | <p class = "caption"> <b>Figure 1:</b> This image is taken from Salis Lab RBS Designer [1] and highlights the synthetic RBS used in BBa_K2194004.</p> | ||
+ | |||
+ | ===Source=== | ||
+ | See the registry pages for negative feedback membrane stress promoter <i>PgntK</i> ([https://parts.igem.org/Part:BBa_K2194002 BBa_K2194002]), cysPUWA proteins ([https://parts.igem.org/Part:BBa_K2194003 BBa_K2194003]), Elowitz RBS ([https://parts.igem.org/Part:BBa_B0034 BBa_B0034]), and sulfate binding protein sbp ([https://parts.igem.org/Part:BBa_K2194001 BBa_K2194001]) sources. | ||
+ | |||
+ | The RBS before <i>cysPUWA</i> has the synthetic sequence 5’AAGCGGACGACACACAAGGCTCCACCAAA3’ and was designed with the “Salis Lab RBS Designer” [1]. | ||
+ | |||
+ | The terminator “L3S3P21” after <i>sbp</i> has the synthetic sequence 5’CCAATTATTGAAGGCCTCCCTAACGGGGGGCCTTTTTTTGTTTCTGGTCTGCC3’. It is sourced from Chen et al [2] and is notable because it is a strong, recombination-resistant terminator. | ||
+ | |||
+ | ===References=== | ||
+ | [1] https://salislab.net/software/forward | ||
+ | <br> | ||
+ | |||
+ | [2] Chen, Ying-Ja et al. “Characterization of 582 Natural and Synthetic Terminators and Quantification of Their Design Constraints.” Nature Methods 10.7 (2013): 659–664. Web. 1 Nov. 2017. |
Latest revision as of 00:02, 2 November 2017
Sulfate Transport System w/ Negative Feedback for Membrane Stress
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1480
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 2296
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
The RBS before cysPUWA was designed using the Salis Lab RBS Designer [1]. The pre-sequence used was the PgntK promoter sequence, and the protein-coding sequence used was the cysP sequence. This particular RBS was chosen (see Figure 1 below) because it had the highest translation rate.
Figure 1: This image is taken from Salis Lab RBS Designer [1] and highlights the synthetic RBS used in BBa_K2194004.
Source
See the registry pages for negative feedback membrane stress promoter PgntK (BBa_K2194002), cysPUWA proteins (BBa_K2194003), Elowitz RBS (BBa_B0034), and sulfate binding protein sbp (BBa_K2194001) sources.
The RBS before cysPUWA has the synthetic sequence 5’AAGCGGACGACACACAAGGCTCCACCAAA3’ and was designed with the “Salis Lab RBS Designer” [1].
The terminator “L3S3P21” after sbp has the synthetic sequence 5’CCAATTATTGAAGGCCTCCCTAACGGGGGGCCTTTTTTTGTTTCTGGTCTGCC3’. It is sourced from Chen et al [2] and is notable because it is a strong, recombination-resistant terminator.
References
[1] https://salislab.net/software/forward
[2] Chen, Ying-Ja et al. “Characterization of 582 Natural and Synthetic Terminators and Quantification of Their Design Constraints.” Nature Methods 10.7 (2013): 659–664. Web. 1 Nov. 2017.