Difference between revisions of "Part:BBa K2382004"

(Usage and Biology)
 
(11 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K2382004 short</partinfo>
 
<partinfo>BBa_K2382004 short</partinfo>
  
This part previously functioned as a DNA recombination and repair protein
 
in E. coli. It is also found that Thioredoxin is capable of increasing the
 
solubility of our protein, MSMEG5998. Therefore, we create this part for
 
future igem teams who want to make their protein more soluble when
 
facing inclusion bodies in E. coli.
 
  
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
  
<!-- -->
+
===<span class='h3bb'>Sequence and Features</span>===
<span class='h3bb'>Sequence and Features</span>
+
 
<partinfo>BBa_K2382004 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K2382004 SequenceAndFeatures</partinfo>
  
Line 21: Line 12:
 
<partinfo>BBa_K2382004 parameters</partinfo>
 
<partinfo>BBa_K2382004 parameters</partinfo>
 
<!-- -->
 
<!-- -->
===Design Notes===
+
 
Thioredoxin could help the protein folding correctly, and make the fusion proteins in soluble form that are biologically active.And we remove the stop coden of Thioredoxin
+
 
(NC_000913.3) so that it can be used in fusion protein designing.
+
===Usage and Biology===
We Insert linker between our two proteins: thioredoxine and MSMEG5998.
+
This part previously functioned as a DNA recombination and repair protein in E. coli. <br>
The purpose is to separate these two proteins
+
Thioredoxin can facilitate protein folding. And this par has its potential of being used in a fusion protein design.<br>
The sequence of Linker contain the polylinker ,and that is: GGTACCCGGGGATCCCTCGAGGGTGGT,
+
It is also found that Thioredoxin is capable of increasing enzyme activity of our protein, MSMEG5998(BBa_K2382001).
There are four restriction site in it:
+
We designed a polylinker that has multiple restriction cutting sites at the end of this part for
Kpn1:GGT’ACC
+
future iGEM teams who want to make their protein more effective.
Sma1: CCC’GGG
+
 
BamH1:GGA’TCC
+
[[File:Csmuxnchu description fig1.png|center|thumb|600px|''<b>BBa_K2382004 showed the gene design of the Thioredoxin fusion system construction.</b> ]]
Xho1:C’TCGAG
+
 
The last of the sequence plus two glycine, and it allow the protein behind linker can be reversed, reducing the probability of protein folding error.
+
==Characterization of the Thioredoxin with polylinker==
 +
 
 +
===References===
 +
Carsten Berndt, Christopher Horst Lillig, Arne Holmgren, Thioredoxins and glutaredoxins as facilitators of protein folding, In Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, Volume 1783, Issue 4, 2008, Pages 641-650, ISSN 0167-4889, https://doi.org/10.1016/j.bbamcr.2008.02.003.
 +
(http://www.sciencedirect.com/science/article/pii/S0167488908000700)
 +
 
 +
Edward R. LaVallie1, Elizabeth A. DiBlasio1, Sharlotte Kovacic1, Kathleen L. Grant1, Paul F. Schendel1 & John M. McCoy1. A Thioredoxin Gene Fusion Expression System That Circumvents Inclusion Body Formation in the E. coli Cytoplasm. Nature Biotechnology 11, 187 - 193 (1993)
 +
doi:10.1038/nbt0293-187
 +
 
 +
Escherichia coli str. K-12 substr. MG1655 https://www.ncbi.nlm.nih.gov/nuccore/NC_000913.3

Latest revision as of 21:51, 1 November 2017

Thioredoxin with polylinker


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 367
    Illegal XhoI site found at 373
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]



Usage and Biology

This part previously functioned as a DNA recombination and repair protein in E. coli.
Thioredoxin can facilitate protein folding. And this par has its potential of being used in a fusion protein design.
It is also found that Thioredoxin is capable of increasing enzyme activity of our protein, MSMEG5998(BBa_K2382001). We designed a polylinker that has multiple restriction cutting sites at the end of this part for future iGEM teams who want to make their protein more effective.

BBa_K2382004 showed the gene design of the Thioredoxin fusion system construction.

Characterization of the Thioredoxin with polylinker

References

Carsten Berndt, Christopher Horst Lillig, Arne Holmgren, Thioredoxins and glutaredoxins as facilitators of protein folding, In Biochimica et Biophysica Acta (BBA) - Molecular Cell Research, Volume 1783, Issue 4, 2008, Pages 641-650, ISSN 0167-4889, https://doi.org/10.1016/j.bbamcr.2008.02.003. (http://www.sciencedirect.com/science/article/pii/S0167488908000700)

Edward R. LaVallie1, Elizabeth A. DiBlasio1, Sharlotte Kovacic1, Kathleen L. Grant1, Paul F. Schendel1 & John M. McCoy1. A Thioredoxin Gene Fusion Expression System That Circumvents Inclusion Body Formation in the E. coli Cytoplasm. Nature Biotechnology 11, 187 - 193 (1993) doi:10.1038/nbt0293-187

Escherichia coli str. K-12 substr. MG1655 https://www.ncbi.nlm.nih.gov/nuccore/NC_000913.3