Difference between revisions of "Part:BBa K2384006"
 
(5 intermediate revisions by 2 users not shown)
Line 4: Line 4:
  
  
−
This is an improve part.This gene is a cold resistant gene from the Arctic cryophile Polaribacter irgensii.It can largely increase the cold resistance of bacterias.CDS sequence optimization in BBa_K538004 is better suited for expression in Bacillus megaterium and we add a 6*His tag at the C end.After that, the promoter (BBa_K143012) and RBS (BBa_K090505) were combined.
+
This is an improve part.This gene is a cold resistant gene from the Arctic cryophile Polaribacter irgensii.It can largely increase the cold resistance of bacterias.CDS sequence optimization in ([[Part:BBa_K538004|BBa_K538004]]) is better suited for expression in Bacillus megaterium and we add a 6*His tag at the C end.After that, the promoter ([[Part:BBa_K143012|BBa_K143012]]) and RBS ([[Part:BBa_K090505|BBa_K090505]]) were combined.
−
CspC introduction：While exposure to low temperatures represses the expression of most proteins, cold shock protein (Csp) expression is actually induced by this. Jones and Inouye showed E. coli's CspA concentration can increase over 200-fold within 1.5 hours, when exposed to cold shock. CspA functions as an RNA chaperone,[2]capable of melting stable secundary structures in mRNA, and in doing so facilitating their translation at low temperatures. Its nucleic acid binding properties are mediated by a β-barrel structure, which is known as the cold shock domain and is common to all cold shock proteins whose structures have been clarified. In particular, two recurring motifs - RNP1 and RNP2 - are essential for cold shock proteins' ability to bind RNA.
+
−
E. coli 's genome comprises a family of 9 highly similar RNA chaperones (CspA through CspI), 4 of which are cold-induced.[6] Deletion of one, two or three of the cold-induced chaperones does not affect cell viability at low temperatures, but a quadruple knock-out strain exhibits a cold-sensitive phenotype. Xia, Ke and Inouye not only made and characterised these knock-out strains, but went on to show the cold-sensitive phenotype can be repressed by overexpressing any of the remaining members of the Csp family, with the exception of CspD. (Overexpressing CspD did, however, increase the cold resistance of the wild-type strain.) The apparent redundancy in the functioning of E. coli 's cold shock proteins suggests that they carry out a task which is key to cell survival.
+
−
Uh et al. identified a blind spot in the scientific community's understanding of cold shock proteins, stating the insights reported above are based mainly on studies of mesophilic bacteria. To fill this gap, they investigated a bacterium isolated from Arctic sea sediment (Polaribacter irgensii) and, following a homology-based selection procedure, cloned two of its genes (CspA and CspC) into E. coli. They demonstrated expression of either of these genes can rescue the cold-sensitive phenotype Xia, Ke and Inouye observed in their quadruple knock-out. In addition to this, they show P. irgensii 's cold shock proteins drastically increase E. coli 's ability to survive freeze/thaw cycles.
+
  
  
−
<!-- Add more about the biology of this part here
+
 
 +
<b>Optimization Report</b>
 +
 
 +
Expression System:Bacillus megaterium
 +
 
 +
Gene Length:189 (bp)
 +
 
 +
 
 +
1.Codon Used Adjustment
 +
The best value is 1 for sequence optimization.
 +
 
 +
 
 +
<table><tr>
 +
<th>[[Image:T--FAFU-CHINA--cspc1.png|thumb|400px|'''Figure 1:Before Codon Adjustment''']]</th>
 +
</tr></table>
 +
 
 +
<table><tr>
 +
<th>[[Image:T--FAFU-CHINA--cspc2.png|thumb|400px|'''Figure 2:After Codon Adjustment''']]</th>
 +
</tr></table>
 +
 
 +
 
 +
2.Codon Used Distribution
 +
Show the relative codon used distribution
 +
 
 +
<table><tr>
 +
<th>[[Image:T--FAFU-CHINA--cspc3.png|thumb|400px|'''Figure 3:Before Optimization''']]</th>
 +
</tr></table>
 +
 
 +
<table><tr>
 +
<th>[[Image:T--FAFU-CHINA--cspc4.png|thumb|400px|'''Figure 4:After Optimization''']]</th>
 +
</tr></table>
 +
 
 +
3.GC Content:
 +
The comparison of GC content between original sequence and optimized sequence
 +
 
 +
<table><tr>
 +
<th>[[Image:T--FAFU-CHINA--cspc5.png|thumb|400px|'''Figure 5:Before Optimization''']]</th>
 +
</tr></table>
 +
 
 +
<table><tr>
 +
<th>[[Image:T--FAFU-CHINA--cspc6.png|thumb|400px|'''Figure 6:After Optimization''']]</th>
 +
</tr></table>
 +
 
 +
4.Restriction Enzyme
 +
 
 +
<table><tr>
 +
<th>[[Image:T--FAFU-CHINA--cspc7-1.png|thumb|400px|'''Figure 7:After Optimization''']]</th>
 +
</tr></table>
 +
 
 +
<table><tr>
 +
<th>[[Image:T--FAFU-CHINA--M-CSPC.jpg|thumb|400px|'''Figure 8: Gene on pSB1C3 Digested with SpeI''']]</th>
 +
</tr></table>
 +
 
 
===Usage and Biology===
 
===Usage and Biology===
  
−
<!-- -->
+
 
−
<span class='h3bb'>Sequence and Featuresatgaataaaggtaccgtaaaatttttcaatgaatctaaaggattcggatttatcactgaagaaggaaacaatgaggagcattttgtgcacgtgtcaggattagtagacgaaattcgtgaaaacgatgaggttgaatttgacttacaagatggaagaaaaggattaaacgcagtaaacgtaagagttatacatcaccatcaccatcac
+
<table><tr>
−
taa</span>
+
<th>[[Image:T--FAFU-CHINA--cspc8.png|thumb|400px|'''Freeze/thaw cycle survival rate of Bacillus megaterium containing an empty vector (red line), a vector carrying CspC gene (blue line).''']]</th>
 +
</tr></table>
 +
 
 +
<span class='h3bb'>Sequence and Features
 
<partinfo>BBa_K2384006 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K2384006 SequenceAndFeatures</partinfo>
  

Latest revision as of 19:00, 1 November 2017


Pveg+RBS+CspC+6*HIS+T1 terminator+T7 terminator


This is an improve part.This gene is a cold resistant gene from the Arctic cryophile Polaribacter irgensii.It can largely increase the cold resistance of bacterias.CDS sequence optimization in (BBa_K538004) is better suited for expression in Bacillus megaterium and we add a 6*His tag at the C end.After that, the promoter (BBa_K143012) and RBS (BBa_K090505) were combined.


Optimization Report

Expression System:Bacillus megaterium

Gene Length:189 (bp)


1.Codon Used Adjustment The best value is 1 for sequence optimization.


Figure 1:Before Codon Adjustment
Figure 2:After Codon Adjustment


2.Codon Used Distribution Show the relative codon used distribution

Figure 3:Before Optimization
Figure 4:After Optimization

3.GC Content: The comparison of GC content between original sequence and optimized sequence

Figure 5:Before Optimization
Figure 6:After Optimization

4.Restriction Enzyme

Figure 7:After Optimization
Figure 8: Gene on pSB1C3 Digested with SpeI

Usage and Biology

Freeze/thaw cycle survival rate of Bacillus megaterium containing an empty vector (red line), a vector carrying CspC gene (blue line).

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]