Difference between revisions of "Part:BBa K2322008"

 
 
(3 intermediate revisions by 2 users not shown)
Line 3: Line 3:
 
<partinfo>BBa_K2322008 short</partinfo>
 
<partinfo>BBa_K2322008 short</partinfo>
  
8
+
[[File:2017CIEICHINA008.png|center|800px|img]]
 +
 
 +
The circuit contain AOX1 promoter, the secretion signal, RBS, SpTPS1 and terminator. This circuit is used to test the expression of SpTPS1. If the circuit works, the SpTPS1 will express extracellular in GS115.
 +
 
 +
Name: BBa_K2322008
 +
 
 +
AOX1 promoter:
 +
Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of SpTPS1, our targeted gene. 
 +
 
 +
Secretion signal:
 +
Secretion signal is to prompt a cell to translocate the protein, in this case, the protein that induced by SpTPS1 can express extracellular. And in this circuit, after collecting the protein that express outside, we can determine the SpTPS1 function as a qualitatively way.
 +
 
 +
 
 +
RBS (Ribosome Binding Site):
 +
A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.Sequence: TCACACAGGAAACA
 +
 
 +
SpTPS1
 +
The Schizosaccharomyces pombe 972h- chromosome I (SpTPS1) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.
 +
 
 +
https://static.igem.org/mediawiki/parts/d/d5/Part%E7%94%A8No.2.png
 +
Figure1: The image of Schizosaccharomyces pombe.
 +
It is assumed that SpTPS1 can enhance the osmotic pressure tolerance of the Schizosaccharomyces pombe, because it is the essential gene in the synthesis of the trehalose. The changing in the expression of SpTPS1 can positively affect the amount of trehalose in the cell.
 +
Trehalose, as a small molecules substance, can increase the cell’s ability of regulating the osmotic pressure. When the osmotic pressure from the environment is too high, the cell will face the dangerous of dehydration or plasmolysis. Trehalose can turn into a gel phase when the cells are dehydrated. The gel phase sugar can prevents the further disruption of internal cell organelles, because the gel can splinting the cell organelles in position.
 +
                               
 +
https://static.igem.org/mediawiki/parts/2/23/Part%E7%94%A8No.3.png
 +
 
 +
With more SpTPS1 expressed, there will be more trehalose in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether SpTPS1 will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.
 +
 
 +
 
 +
Primer of this part
 +
AOX-FP: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT
 +
SP-B-RP: TGACACCTTGCCCTTTTTTGCCCGGACTGCAGTTAAGAAGAAGAGTTCATAGACAAAAC
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
Line 11: Line 42:
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K2322008 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K2322008 SequenceAndFeatures</partinfo>
 
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  

Latest revision as of 14:49, 1 November 2017


-AOX1 promoter-S-RBS-SpTPS1-

img

The circuit contain AOX1 promoter, the secretion signal, RBS, SpTPS1 and terminator. This circuit is used to test the expression of SpTPS1. If the circuit works, the SpTPS1 will express extracellular in GS115.

Name: BBa_K2322008

AOX1 promoter: Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of SpTPS1, our targeted gene.

Secretion signal: Secretion signal is to prompt a cell to translocate the protein, in this case, the protein that induced by SpTPS1 can express extracellular. And in this circuit, after collecting the protein that express outside, we can determine the SpTPS1 function as a qualitatively way.


RBS (Ribosome Binding Site): A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.Sequence: TCACACAGGAAACA

SpTPS1 The Schizosaccharomyces pombe 972h- chromosome I (SpTPS1) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.

Part%E7%94%A8No.2.png Figure1: The image of Schizosaccharomyces pombe. It is assumed that SpTPS1 can enhance the osmotic pressure tolerance of the Schizosaccharomyces pombe, because it is the essential gene in the synthesis of the trehalose. The changing in the expression of SpTPS1 can positively affect the amount of trehalose in the cell. Trehalose, as a small molecules substance, can increase the cell’s ability of regulating the osmotic pressure. When the osmotic pressure from the environment is too high, the cell will face the dangerous of dehydration or plasmolysis. Trehalose can turn into a gel phase when the cells are dehydrated. The gel phase sugar can prevents the further disruption of internal cell organelles, because the gel can splinting the cell organelles in position.

Part%E7%94%A8No.3.png

With more SpTPS1 expressed, there will be more trehalose in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether SpTPS1 will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.


Primer of this part AOX-FP: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT SP-B-RP: TGACACCTTGCCCTTTTTTGCCCGGACTGCAGTTAAGAAGAAGAGTTCATAGACAAAAC

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1
    Illegal BamHI site found at 938
    Illegal XhoI site found at 1192
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]