Difference between revisions of "Part:BBa K2322002"

Line 33: Line 33:
 
We cultured the device that ligated vector pPIC9K(containing gene ScTPS1)in YPD. We used 1% methanol to induce the protein that will produce, After ultrasonication, we broke the membrane of the yeast and then used SDS-PAGE to test expression of ScTPS1.  
 
We cultured the device that ligated vector pPIC9K(containing gene ScTPS1)in YPD. We used 1% methanol to induce the protein that will produce, After ultrasonication, we broke the membrane of the yeast and then used SDS-PAGE to test expression of ScTPS1.  
  
蛋白胶图
+
[[File:Bluejiao111.png|center|380px|img]]
 
Fig 1. The SDS-PAGE electrophoresis gel of the protein with ScTPS1 ligation.  
 
Fig 1. The SDS-PAGE electrophoresis gel of the protein with ScTPS1 ligation.  
 
Line 1, protein with ScTPS1 without induced; Line 2, protein with SctTPS1 induced for 24 hrs; Line 3, protein with ScTPS1 w induced for 48 hrs. white arrows shows the target recombined protein.
 
Line 1, protein with ScTPS1 without induced; Line 2, protein with SctTPS1 induced for 24 hrs; Line 3, protein with ScTPS1 w induced for 48 hrs. white arrows shows the target recombined protein.
Line 40: Line 40:
 
When the salinity of the environment is lower than 2%, the difference of survivability between the original GS115 and the GS115 containing ScTPS1 is not apparent. When the salinity of the environment is higher than 2%, the GS115 containing ScTPS1 has a remarkably higher survivability.
 
When the salinity of the environment is lower than 2%, the difference of survivability between the original GS115 and the GS115 containing ScTPS1 is not apparent. When the salinity of the environment is higher than 2%, the GS115 containing ScTPS1 has a remarkably higher survivability.
  
耐盐图
+
[[File:Tutututu.png|center|380px|img]]
 
Figure 2: The figure shows the survivability  results of the GS115 along with the ScTPS1 contained GS115. 1 is GS115, 2 is ScTPS1 for extracellular expression, and 3 is ScTPS1 for intracellular expression.
 
Figure 2: The figure shows the survivability  results of the GS115 along with the ScTPS1 contained GS115. 1 is GS115, 2 is ScTPS1 for extracellular expression, and 3 is ScTPS1 for intracellular expression.
  

Revision as of 13:55, 1 November 2017


-AOX1 promoter-RBS-ScTPS1-

Part%E7%94%A8no.4.png


This circuit contains a AOX1 promoter, a ribosome binding site, a ScTPS1 gene. This circuit is used to test the expression of ScTPS1. If the circuit work, the ScTPS1 will express normally in GS115 and affect the amount of trehalose in GS115.

Primer of this part AOX-FP: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT SC-B-RP: TGACACCTTGCCCTTTTTTGCCGGACTGCAGTTAATTTTTAGTTGCTGAAGATGATC

AOX1 promoter: Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of ScTPS1, our targeted gene.

RBS (Ribosome Binding Site): A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.Sequence: TCACACAGGAAACA

ScTPS1: Saccharomyces cerevisiae trehalose-6-phosphate synthase (ScTPS1) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.

Part%E7%94%A8No.2.png Figure1: The image of Schizosaccharomyces pombe.

It is assumed that ScTPS1 can enhance the osmotic pressure tolerance of the Schizosaccharomyces pombe, because it is the essential gene in the synthesis of the trehalose. The changing in the expression of ScTPS1 can positively affect the amount of trehalose in the cell. Trehalose, as a small molecules substance, can increase the cell’s ability of regulating the osmotic pressure. When the osmotic pressure from the environment is too high, the cell will face the dangerous of dehydration or plasmolysis. Trehalose can turn into a gel phase when the cells are dehydrated. The gel phase sugar can prevents the further disruption of internal cell organelles, because the gel can splinting the cell organelles in position.

With more ScTPS1 expressed, there will be more trehalose in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether ScTPS1 will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.


We cultured the device that ligated vector pPIC9K(containing gene ScTPS1)in YPD. We used 1% methanol to induce the protein that will produce, After ultrasonication, we broke the membrane of the yeast and then used SDS-PAGE to test expression of ScTPS1.

img

Fig 1. The SDS-PAGE electrophoresis gel of the protein with ScTPS1 ligation. Line 1, protein with ScTPS1 without induced; Line 2, protein with SctTPS1 induced for 24 hrs; Line 3, protein with ScTPS1 w induced for 48 hrs. white arrows shows the target recombined protein.

According to the results of the salinity test of the food waste, we decided to use the treatments with a salinity from 0% to 3%. When the salinity of the environment is lower than 2%, the difference of survivability between the original GS115 and the GS115 containing ScTPS1 is not apparent. When the salinity of the environment is higher than 2%, the GS115 containing ScTPS1 has a remarkably higher survivability.

img

Figure 2: The figure shows the survivability results of the GS115 along with the ScTPS1 contained GS115. 1 is GS115, 2 is ScTPS1 for extracellular expression, and 3 is ScTPS1 for intracellular expression.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1
    Illegal BamHI site found at 938
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]