Difference between revisions of "Part:BBa K2322008"

Revision as of 13:00, 1 November 2017

-AOX1 promoter-S-RBS-SpTPS1-

The circuit contain AOX1 promoter, the secretion signal, RBS, SpTPS1 and terminator. This circuit is used to test the expression of SpTPS1. If the circuit works, the SpTPS1 will express extracellular in GS115.

Name: BBa_K2322008

AOX1 promoter: Sequence of the primer: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT

Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of SpTPS1, our targeted gene.

Secretion signal:

Secretion signal is to prompt a cell to translocate the protein, in this case, the protein that induced by SpTPS1 can express extracellular. And in this circuit, after collecting the protein that express outside, we can determine the SpTPS1 function as a qualitatively way.

RBS (Ribosome Binding Site):

A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.

Sequence: TCACACAGGAAACA

Sequence and Features