Difference between revisions of "Part:BBa K2448038"

 
(3 intermediate revisions by the same user not shown)
Line 3: Line 3:
 
<partinfo>BBa_K2448038 short</partinfo>
 
<partinfo>BBa_K2448038 short</partinfo>
  
This part is the [https://parts.igem.org/Part:pSB1C3 pSB1C3] backbone vector with a built-in LacIq sequence and with the [[Part:BBa_J04450|BBa_J04450]] reporter.
+
This part is the [https://parts.igem.org/Part:pSB1C3 pSB1C3] backbone vector with a built-in LacIq sequence provided with the [[Part:BBa_J04450|BBa_J04450]] reporter.
  
 
===Usage and Biology===
 
===Usage and Biology===
Line 11: Line 11:
 
pSB1C3 is the iGEM workhorse for gene expression. However, when it comes to the of use LacI regulated promoters, very frequently significant leakage is observe due to its important copy number, which leads to important regulation problems. This issue can be addressed either by including the LacI coding sequence into the construct or by using only LacI overexpressing cells.
 
pSB1C3 is the iGEM workhorse for gene expression. However, when it comes to the of use LacI regulated promoters, very frequently significant leakage is observe due to its important copy number, which leads to important regulation problems. This issue can be addressed either by including the LacI coding sequence into the construct or by using only LacI overexpressing cells.
  
To facilitate further use of this plasmid, we designed a pSB1C3 with a built-in LacI coding sequence. This protein is overexpressed thanks to a mutated promoter (the LacIq allele).  
+
To facilitate further use of this plasmid, we designed a pSB1C3 with a built-in LacI coding sequence under the control of a mutated version of its own natural promoter known as LacIq. This is a single C to T change at −35 of the promoter region of LacI which leads to a 10-fold increase in LacI expression [1].
  
The LacIq has been recovered from the pQlinkH plasmid [1] and directly inserted between the origin of replication and the VR primer of pSB1C3 thus improving the general regulation of LacI related parts. This part is provides with a reporter ([[Part:BBa_J04450|BBa_J04450]]).
+
The LacIq has been recovered from the pQLinkH plasmid [2] and directly inserted between the origin of replication and the VR primer of pSB1C3 thus improving the general regulation of LacI related parts. This part is provided with a reporter ([[Part:BBa_J04450|BBa_J04450]]).
  
A relevant application of this part would be the use with the Universal Biosensing Chassis ([[Part:BBa_K2448023|BBa_K2448023]] and [[Part:BBa_K2448024|BBa_K2448024]]) to build a transcription factor based biosensor finely regulated.
+
A relevant application of this part would be the use with it with our Universal Biosensing Chassis ([[Part:BBa_K2448023|BBa_K2448023]] and [[Part:BBa_K2448024|BBa_K2448024]]) to build a transcription factor based biosensor finely regulated.
 
+
pSB1C3_LacIq sequence (suffix to prefix):
+
 
+
TACTAGTAGCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGCTGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGATGGTGGTTAACGGCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAAGGTTTTGCACCATTCGATGGTGTCTCCATGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGCTCGAGGCTTGGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTCTGAACAAATCCAGATGGAGTTCTGAGGTCATTACTGGATCTATCAACAGGAGTCCAAGCGAGCTCGATATCAAATTACGCCCCGCCCTGCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCCGATCAACTCGAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAG
+
  
 
<!-- -->
 
<!-- -->

Latest revision as of 21:48, 31 October 2017


pSB1C3 LacIq

This part is the pSB1C3 backbone vector with a built-in LacIq sequence provided with the BBa_J04450 reporter.

Usage and Biology

pSB1C3 is a well know high copy number plasmid (RFC [10]) carrying a chloramphenicol resistance, a pMB1 replication origin (100-300 copy per cell) and highly efficient terminators bracketing its suffix and prefix regions thus preventing transcription from part sequences out into the vector.

pSB1C3 is the iGEM workhorse for gene expression. However, when it comes to the of use LacI regulated promoters, very frequently significant leakage is observe due to its important copy number, which leads to important regulation problems. This issue can be addressed either by including the LacI coding sequence into the construct or by using only LacI overexpressing cells.

To facilitate further use of this plasmid, we designed a pSB1C3 with a built-in LacI coding sequence under the control of a mutated version of its own natural promoter known as LacIq. This is a single C to T change at −35 of the promoter region of LacI which leads to a 10-fold increase in LacI expression [1].

The LacIq has been recovered from the pQLinkH plasmid [2] and directly inserted between the origin of replication and the VR primer of pSB1C3 thus improving the general regulation of LacI related parts. This part is provided with a reporter (BBa_J04450).

A relevant application of this part would be the use with it with our Universal Biosensing Chassis (BBa_K2448023 and BBa_K2448024) to build a transcription factor based biosensor finely regulated.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 3218
    Illegal SpeI site found at 2
    Illegal PstI site found at 16
    Illegal NotI site found at 9
    Illegal NotI site found at 3224
  • 21
    INCOMPATIBLE WITH RFC[21]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.
    Illegal EcoRI site found at 3218
    Illegal XhoI site found at 2202
    Illegal XhoI site found at 3094
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal prefix found at 3218
    Illegal suffix found at 2
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal prefix found at 3218
    Plasmid lacks a suffix.
    Illegal XbaI site found at 3233
    Illegal SpeI site found at 2
    Illegal PstI site found at 16
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Plasmid lacks a prefix.
    Plasmid lacks a suffix.