Difference between revisions of "Part:BBa K2342006"
(→Usage and Biology) |
|||
| (16 intermediate revisions by 2 users not shown) | |||
| Line 3: | Line 3: | ||
<partinfo>BBa_K2342006 short</partinfo> | <partinfo>BBa_K2342006 short</partinfo> | ||
| − | This part allows expression of | + | This part allows expression of DCD-1L antimicrobial peptide in form of a fusion protein accompanied with His6x-Smt3 tag. The construct can be purified using with commercially available and widely used affinity chromatography columns designed for His6x tag. Smt3 is tag is used to keep antimicrobial peptide, DCD-1L, in inactive form by blocking its adhesion to phospholipid bilayer of the production host due to relatively large size of the tag. One major advantage of the fusion system used is that it facilitated easier detection of the peptide with a conventional method like SDS-PAGE. Also, SUMO tag is beneficial due to its effect on solubility of fusion peptide which significantly eases purification step. After purification, to cleave off His6x-Smt3 tag, Ulp1 enzyme that is known for its robust and specific proteolytic activity against SUMO fusion proteins, is used to obtain free DCD-1L antimicrobial peptide. |
| Line 37: | Line 37: | ||
===1. Biology and system=== | ===1. Biology and system=== | ||
| − | Dermcidin is an antimicrobial peptide (AMP) found in primates with no homology to other know AMPs. (2) It is expressed in a constitutive manner in eccrine sweat glands and secreted to epidermal surface as a part of first line of defense. (3) Mature Dermcidin precursor is 110 amino acid long, including signal peptide. Once antimicrobial peptide precursor is secreted with sweat to epidermal surface, 19 amino acid long signal peptide is cleaved, and it goes under further proteolytic processing leading to several Dermcidin derived peptides such as | + | Dermcidin is an antimicrobial peptide (AMP) found in primates with no homology to other know AMPs. (2) It is expressed in a constitutive manner in eccrine sweat glands and secreted to epidermal surface as a part of first line of defense. (3) Mature Dermcidin precursor is 110 amino acid long, including signal peptide. Once antimicrobial peptide precursor is secreted with sweat to epidermal surface, 19 amino acid long signal peptide is cleaved, and it goes under further proteolytic processing leading to several Dermcidin derived peptides such as DCD-1 and DCD-1L. DCD-1L is one of the most abundant form of dermcidin derived peptide. DCD-1L is a 48 amino acid long anionic peptide active against wide spectrum of bacteria including Staphylococcus aureus, Escherichia coli, and Propionibacterium acnes. (2,6) Although the precise mode of action is not entirely explored, it is thought that DCD-1L hexamers form pores on bacterial membrane leading to cell death. (5) |
| − | Ulp1 enzyme, known for its robust and specific proteolytic activity against SUMO fusion proteins, is utilized to cleave of 6XHis-Smt3 tag is used for expression and purification. (4) | + | Ulp1 enzyme, known for its robust and specific proteolytic activity against SUMO fusion proteins, is utilized to cleave of 6XHis-Smt3 tag is used for expression and purification. (4) His6x tag in N-terminus is used for purification with immobilized metal ion affinity chromatography (IMAC) columns designed for histidine tagged proteins. Employing of Smt3 tag is beneficial in several aspects in our project. Ulp1 enzyme is able to cleavage fusion peptide by recognizing Smt3. Smt3 tag keeps antimicrobial peptide in inactivation form so that the peptide is not toxic to production host, by blocking its adhesion due to relatively large size of His6x-Smt3 tag. Another advantage of using Smt3 is its effect on solubility and preventing inclusion bodies of fusion peptide which significantly eases purification step. Finally, it facilitates easier detection of the peptide with a conventional method like SDS-PAGE. |
| + | |||
| + | Our expression system is inducible with addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to expression culture, since IPTG induces T7 RNA polymerase promoter leading to expression of gene of interest in plasmid. | ||
| − | |||
| − | |||
| − | [[File:BBa_K2342006_Figure_1.jpeg| | + | [[File:BBa_K2342006_Figure_1.jpeg|900px|center]] |
| Line 50: | Line 50: | ||
| − | The pET28a(+) vector contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This promoter can be induced by isopropyl-β-D-thiogalactopyranoside (IPTG) (ref. Novagen pET System Manual) | + | The pET28a(+) vector (Figure 1) contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This promoter can be induced by isopropyl-β-D-thiogalactopyranoside (IPTG) (ref. Novagen pET System Manual) |
| Line 56: | Line 56: | ||
| − | The | + | The sequence of the cloned part was confirmed from sequencing results. All the bases of the cloned part were confirmed to be correct. |
| − | [[File:BBa_K2342006_Figure_2.jpeg| | + | [[File:BBa_K2342006_Figure_2.jpeg|900px|center]] |
=== 2. Small scale Production === | === 2. Small scale Production === | ||
| Line 65: | Line 65: | ||
=== 2.1 Cultivation and Induction of protein expression=== | === 2.1 Cultivation and Induction of protein expression=== | ||
| − | For small scale production, 3-4 colonies from the transformation plates were inoculated (the expression strain cells | + | For small scale production, 3-4 colonies from the transformation plates were inoculated (the expression strain cells used-c2566) transformed with plasmids carrying the gene of interest) in 7 ml LB-kanamycin (50 μg/ml working concentration) and the cells were grown at +37 °C until the culture reached the OD600 value ~0,51. After the growing the cells, the expression of the gene of interest was induced by adding a final concentration of 0,5 mM IPTG in the cultures and cells continued to grow at +37 °C shaking. After induction of protein expression the OD600 value of the culture was measured (Figure 3) and the cells were observed to be growing normally. The production of our antimicrobial peptide had not interfered with the bacterial growth. Hence the Smt3 fusion protein system for producing the antimicrobial peptides in E. coli was working. |
| − | + | ||
| − | + | ||
| + | [[File:BBa_K2342006_Figure_3.png|600px|center]] | ||
===2.2 Purification === | ===2.2 Purification === | ||
| Line 74: | Line 73: | ||
Then, 4h after induction, we pelleted the cells by centrifuging at 12000 x g for 1 minute and discarded the supernatant. Then resuspended the pellet in 100 μl of ThermoFisher Scientific B-PER Bacterial Protein Extraction Reagent. | Then, 4h after induction, we pelleted the cells by centrifuging at 12000 x g for 1 minute and discarded the supernatant. Then resuspended the pellet in 100 μl of ThermoFisher Scientific B-PER Bacterial Protein Extraction Reagent. | ||
| − | After equilibrating the Qiagen Ni-NTA spin columns with 600 μl of NPI-10 buffer (50 nM NaPi, 300 mM NaCl, pH 8,0) | + | After equilibrating the Qiagen Ni-NTA spin columns with 600 μl of NPI-10 buffer (50 nM NaPi, 300 mM NaCl, pH 8,0) the protein purification was carried out. The samples were loaded onto the spin columns and centrifuged at 1600 rpm for 5 minutes. Tis was followed by washing the columns with 600 μl of NPI-20 buffer (50 mM NaPi, 300 mM NaCl, 30 mM imidazole, pH 8,0). The proteins were eluted in 300 μl of NPI-500 buffer (50 mM NaPi, 300 mM NaCl, 250 mM imidazole, pH 8,0). The used spin columns were soaked in 0,1 M EDTA solution and stored at +4 °C. The samples from different flow throughs and elution were then analysed using SDS PAGE. |
===2.3 SDS-Page of protein purification=== | ===2.3 SDS-Page of protein purification=== | ||
| Line 84: | Line 83: | ||
| − | [[File:BBa_K2342006_Figure_5.png| | + | [[File:BBa_K2342006_Figure_5.png|600px|center]] |
| Line 93: | Line 92: | ||
Large scale protein expression was started by inoculating 3-10 single colonies (of the expression strain cells transformed with plasmids carrying the gene of interest) in 25mL of LB medium with the 50ug/ml Kanamycin and Incubated at +30°C with shaking overnight. The next day we prewarmed 500 mL of LB medium to +37°C in a 2L Erlenmeyer flask and Added 50 ug/ml Kanamycin. Then inoculated 3-5 mL of the overnight grown preculture in 500 mL prewarmed LB. Flask was incubated at +37°C with shaking until OD600 value reached 0.6. | Large scale protein expression was started by inoculating 3-10 single colonies (of the expression strain cells transformed with plasmids carrying the gene of interest) in 25mL of LB medium with the 50ug/ml Kanamycin and Incubated at +30°C with shaking overnight. The next day we prewarmed 500 mL of LB medium to +37°C in a 2L Erlenmeyer flask and Added 50 ug/ml Kanamycin. Then inoculated 3-5 mL of the overnight grown preculture in 500 mL prewarmed LB. Flask was incubated at +37°C with shaking until OD600 value reached 0.6. | ||
| − | Protein expression was then induced with a final concentration of 0.5mM IPTG and | + | Protein expression was then induced with a final concentration of 0.5mM IPTG and the culture was incubated at +37°C for 4 hours. The culture was then transferred to a 1L sorvall centrifuge bottle and cells harvested by centrifuging at 5,000 x g for 10 minutes at +16°C. The supernatant was discarded and the pellet resuspended in Buffer A (50mM NaPi, 300mM NaCl, pH 8.0) to obtain a final volume of ~35mL. Samples were taken at different stages as shown below for SDS analysis. We can see our protein of interest produced after 2 hours and 4 hour incubation and in the lysate (figure 6). |
| − | [[File:BBa_K2342006_Figure_6_aaltohelsinki9.png| | + | [[File:BBa_K2342006_Figure_6_aaltohelsinki9.png|500px|center]] |
| − | + | ||
=== 3.2 Cell Lysis and Purification === | === 3.2 Cell Lysis and Purification === | ||
| Line 103: | Line 101: | ||
The 35 ml sample with harvested cells was then lysed using Emulsiflex machine and was injected into the ÄKTA Machine for protein purification using His tag affinity method. During purification, flow-through and elution fractions (Figure 8) were collected on a well plate. Elution fractions were selected with the desired protein from the graph (Figure. 7), and ran elution fractions on SDS-PAGE. Fractions that contain the desired protein were pooled, frozen in liquid nitrogen and stored at -20°C. | The 35 ml sample with harvested cells was then lysed using Emulsiflex machine and was injected into the ÄKTA Machine for protein purification using His tag affinity method. During purification, flow-through and elution fractions (Figure 8) were collected on a well plate. Elution fractions were selected with the desired protein from the graph (Figure. 7), and ran elution fractions on SDS-PAGE. Fractions that contain the desired protein were pooled, frozen in liquid nitrogen and stored at -20°C. | ||
| + | |||
[[File:BBa_K2342006_Figure_7_aaltohelsinki9.png|600px|center]] | [[File:BBa_K2342006_Figure_7_aaltohelsinki9.png|600px|center]] | ||
| + | |||
[[File:BBa_K2342006_Figure_8_aaltohelsinki9.jpg|600px|center]] | [[File:BBa_K2342006_Figure_8_aaltohelsinki9.jpg|600px|center]] | ||
| − | |||
===3.3 SDS-Page of protein purification=== | ===3.3 SDS-Page of protein purification=== | ||
After running the selected fractions on the gel, it could be seen that eluates (Figure 9) D1, D1, A2, B2, C2, D2, A3, B3, C3 and D3 had our desired protein. Hence these were collected for further protein concentration and buffer exchange step and rest eluates were discarded. | After running the selected fractions on the gel, it could be seen that eluates (Figure 9) D1, D1, A2, B2, C2, D2, A3, B3, C3 and D3 had our desired protein. Hence these were collected for further protein concentration and buffer exchange step and rest eluates were discarded. | ||
| + | |||
[[File:BBa_K2342006_Figure_9_aaltohelsinki9.jpg|600px|center]] | [[File:BBa_K2342006_Figure_9_aaltohelsinki9.jpg|600px|center]] | ||
| − | |||
===4. Concentration process and SDS PAGE=== | ===4. Concentration process and SDS PAGE=== | ||
| Line 122: | Line 121: | ||
For concentrating the peptide, first filter was washed with Milli-Q (~20mL). Then columns were filled with 20mL of the protein sample and Centrifuge at 3,000 x g for 30-45 minutes at +4°C (approximately half of the sample will go through the filter). The remaining sample were mixed by pipetting up and down and the centrifugation repeated. Meanwhile flow-through fractions are collected and run on SDS-PAGE to verify that the filter is not leaking before discarding them. | For concentrating the peptide, first filter was washed with Milli-Q (~20mL). Then columns were filled with 20mL of the protein sample and Centrifuge at 3,000 x g for 30-45 minutes at +4°C (approximately half of the sample will go through the filter). The remaining sample were mixed by pipetting up and down and the centrifugation repeated. Meanwhile flow-through fractions are collected and run on SDS-PAGE to verify that the filter is not leaking before discarding them. | ||
| − | When ~5 mL of the old buffer is left above the filter, the column was filled up to 20 mL with our new NaPi buffer. Centrifuged at 3,000 x g for ~1 hour at +4°C. Repeated the step above (filling up the column with the new buffer) twice (or such that the amount of old buffer left in the sample is sufficiently low). In the end the desired sample volume in the column is ~5mL. The protein samples are then collected and stored in liquid nitrogen at -20°C. | + | When ~5 mL of the old buffer is left above the filter, the column was filled up to 20 mL with our new NaPi buffer. Centrifuged at 3,000 x g for ~1 hour at +4°C. Repeated the step above (filling up the column with the new buffer) twice (or such that the amount of old buffer left in the sample is sufficiently low). In the end the desired sample volume in the column is ~5mL (figure 10). The protein samples are then collected and stored in liquid nitrogen at -20°C. |
| Line 129: | Line 128: | ||
===5. Ulp1 enzyme digestion and SDS PAGE=== | ===5. Ulp1 enzyme digestion and SDS PAGE=== | ||
| − | For digesting | + | For digesting His6x-Smt3-DCD-1L with Ulp1 to obtain free DCD-1L, 0.5μL of Ulp1 protease was added to 50μL of the purified protein (concentrated in e.g. NaPi buffer). The suitable digestion time was determined by incubating the protein with Ulp1 for different time points and running them on SDS-PAGE. We can see that 10 mins of Incubation at RT is enough. |
| + | |||
[[File:BBa_K2342006_Figure_11_aaltohelsinki9.jpg|600px|center]] | [[File:BBa_K2342006_Figure_11_aaltohelsinki9.jpg|600px|center]] | ||
| − | Undigested samples are highlighted with a white box: | + | Undigested samples are highlighted with a white box: His6x-Smt3-DCD-1L 18.3kDa. The desired peptides after digestion are highlighted with a red box: DCD-1L 4.82kDa. The digested N-terminus containing the His6x-tag and the Smt3-tag (13.5kDa) is highlighted with black. Since the mass of DCD-1L peptide is very low, it was challenging to observe the corresponding bands on the SDS-PAGE gel. Instead, the band corresponding to the His6x-Smt3 part can be clearly observed from the gel. |
| − | + | ||
===6. MALDI-TOF Analysis === | ===6. MALDI-TOF Analysis === | ||
| − | The sample after Ulp1 digestion was analysed using mass | + | The sample after Ulp1 digestion was analysed using mass spectrometry to verify DCD-1L. We use matrix-assisted laser desorption/ionization-time of flight/time of flight (MALDI-TOF-TOF) mass spectrometer (UltrafleXtreamTM Bruker, Aalto department of biotechnology and chemical technology facilities, Espoo, Finland) equipped with a 200-Hz smart-beam 1 laser (337 nm, 4 ns pulse) to identify masses of proteins/peptides. Data collection was carried out by operating the instrument in positive ion mode controlled by the flex software packaged (FlexControl, FlexAnalysis). 5,000 laser shots were accumulated per each spectrum in MS modes. Protein Calibration Standard mixture I, II. The peak which is exactly half of our desired mass is due to the doubly-charged proteins/peptides. Since, the result is mass/charge ratio, when the charge is 2 we get half the mass as the result. |
| − | [[File:BBa_K2342006_Figure_12_aaltohelsinki9.png| | + | [[File:BBa_K2342006_Figure_12_aaltohelsinki9.png|800px|center]] |
| + | ===7. Antimicrobial activity assay=== | ||
| − | |||
| − | + | Bacterial cultures were grown until the OD reached 0.05 with corresponding 1.4*10^8 CFU/ml. The samples were incubated at 37°C, shaking for 40 mins with the respective antimicrobial peptides Nisin, DCD-1L and LL-37 (concentration used: 100 ug/ml). After incubation, the OD of the cells were measured. It was observed that the OD values in all the three samples with LL37, Nisin and produced DCD-1L dropped after 40 minutes indicating antimicrobial property of the peptides. | |
| − | Bacterial cultures were grown until the OD reached 0.05 with corresponding 1.4*10^8 CFU/ml. The samples were incubated at 37°C, shaking for 40 mins with the respective antimicrobial peptides Nisin, | + | |
[[File:BBa_K2342009_Figure_7_aaltohelsinki9.png|600px|thumb|center|Figure 13.Image representing data in terms of the % of cells (E. coli DH5 alpha) killed after 40 mins of incubation with Chloramphenicol, Nisin, DCD-1L and LL-37]] | [[File:BBa_K2342009_Figure_7_aaltohelsinki9.png|600px|thumb|center|Figure 13.Image representing data in terms of the % of cells (E. coli DH5 alpha) killed after 40 mins of incubation with Chloramphenicol, Nisin, DCD-1L and LL-37]] | ||
| − | |||
===References=== | ===References=== | ||
Latest revision as of 20:27, 31 October 2017
DCD1L peptide linked to sumo fusion peptide with His6x tag
This part allows expression of DCD-1L antimicrobial peptide in form of a fusion protein accompanied with His6x-Smt3 tag. The construct can be purified using with commercially available and widely used affinity chromatography columns designed for His6x tag. Smt3 is tag is used to keep antimicrobial peptide, DCD-1L, in inactive form by blocking its adhesion to phospholipid bilayer of the production host due to relatively large size of the tag. One major advantage of the fusion system used is that it facilitated easier detection of the peptide with a conventional method like SDS-PAGE. Also, SUMO tag is beneficial due to its effect on solubility of fusion peptide which significantly eases purification step. After purification, to cleave off His6x-Smt3 tag, Ulp1 enzyme that is known for its robust and specific proteolytic activity against SUMO fusion proteins, is used to obtain free DCD-1L antimicrobial peptide.
Contents:
1. Biology and system
2. Small scale Production
2.1 Cultivation and Induction
2.2 Purification
2.3 SDS-Page of protein purification
3 Large Scale Production (Half liter batch)
3.1 Cultivations and Induction
3.2 Cell Lysis and Purification
3.4 SDS-Page of protein purification
4. Concentration process and SDS PAGE
5. Ulp1 enzyme digestion and SDS PAGE
6. MALDI-TOF Analysis
7. Antimicrobial activity
1. Biology and system
Dermcidin is an antimicrobial peptide (AMP) found in primates with no homology to other know AMPs. (2) It is expressed in a constitutive manner in eccrine sweat glands and secreted to epidermal surface as a part of first line of defense. (3) Mature Dermcidin precursor is 110 amino acid long, including signal peptide. Once antimicrobial peptide precursor is secreted with sweat to epidermal surface, 19 amino acid long signal peptide is cleaved, and it goes under further proteolytic processing leading to several Dermcidin derived peptides such as DCD-1 and DCD-1L. DCD-1L is one of the most abundant form of dermcidin derived peptide. DCD-1L is a 48 amino acid long anionic peptide active against wide spectrum of bacteria including Staphylococcus aureus, Escherichia coli, and Propionibacterium acnes. (2,6) Although the precise mode of action is not entirely explored, it is thought that DCD-1L hexamers form pores on bacterial membrane leading to cell death. (5) Ulp1 enzyme, known for its robust and specific proteolytic activity against SUMO fusion proteins, is utilized to cleave of 6XHis-Smt3 tag is used for expression and purification. (4) His6x tag in N-terminus is used for purification with immobilized metal ion affinity chromatography (IMAC) columns designed for histidine tagged proteins. Employing of Smt3 tag is beneficial in several aspects in our project. Ulp1 enzyme is able to cleavage fusion peptide by recognizing Smt3. Smt3 tag keeps antimicrobial peptide in inactivation form so that the peptide is not toxic to production host, by blocking its adhesion due to relatively large size of His6x-Smt3 tag. Another advantage of using Smt3 is its effect on solubility and preventing inclusion bodies of fusion peptide which significantly eases purification step. Finally, it facilitates easier detection of the peptide with a conventional method like SDS-PAGE.
Our expression system is inducible with addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to expression culture, since IPTG induces T7 RNA polymerase promoter leading to expression of gene of interest in plasmid.
Promoter information
The pET28a(+) vector (Figure 1) contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This promoter can be induced by isopropyl-β-D-thiogalactopyranoside (IPTG) (ref. Novagen pET System Manual)
Sequencing results
The sequence of the cloned part was confirmed from sequencing results. All the bases of the cloned part were confirmed to be correct.
2. Small scale Production
2.1 Cultivation and Induction of protein expression
For small scale production, 3-4 colonies from the transformation plates were inoculated (the expression strain cells used-c2566) transformed with plasmids carrying the gene of interest) in 7 ml LB-kanamycin (50 μg/ml working concentration) and the cells were grown at +37 °C until the culture reached the OD600 value ~0,51. After the growing the cells, the expression of the gene of interest was induced by adding a final concentration of 0,5 mM IPTG in the cultures and cells continued to grow at +37 °C shaking. After induction of protein expression the OD600 value of the culture was measured (Figure 3) and the cells were observed to be growing normally. The production of our antimicrobial peptide had not interfered with the bacterial growth. Hence the Smt3 fusion protein system for producing the antimicrobial peptides in E. coli was working.
2.2 Purification
Then, 4h after induction, we pelleted the cells by centrifuging at 12000 x g for 1 minute and discarded the supernatant. Then resuspended the pellet in 100 μl of ThermoFisher Scientific B-PER Bacterial Protein Extraction Reagent.
After equilibrating the Qiagen Ni-NTA spin columns with 600 μl of NPI-10 buffer (50 nM NaPi, 300 mM NaCl, pH 8,0) the protein purification was carried out. The samples were loaded onto the spin columns and centrifuged at 1600 rpm for 5 minutes. Tis was followed by washing the columns with 600 μl of NPI-20 buffer (50 mM NaPi, 300 mM NaCl, 30 mM imidazole, pH 8,0). The proteins were eluted in 300 μl of NPI-500 buffer (50 mM NaPi, 300 mM NaCl, 250 mM imidazole, pH 8,0). The used spin columns were soaked in 0,1 M EDTA solution and stored at +4 °C. The samples from different flow throughs and elution were then analysed using SDS PAGE.
2.3 SDS-Page of protein purification
From the SDS gel image (Figure 4), the expression of the desired construct could be observed after 2 hours and 4 hours incubation. Further after purification process, our desired construct could be observed in lysate (lane 9) and eluate (lane 13) samples.
3 Large Scale Production (Half liter batch)
3.1 Cultivations and Induction
Large scale protein expression was started by inoculating 3-10 single colonies (of the expression strain cells transformed with plasmids carrying the gene of interest) in 25mL of LB medium with the 50ug/ml Kanamycin and Incubated at +30°C with shaking overnight. The next day we prewarmed 500 mL of LB medium to +37°C in a 2L Erlenmeyer flask and Added 50 ug/ml Kanamycin. Then inoculated 3-5 mL of the overnight grown preculture in 500 mL prewarmed LB. Flask was incubated at +37°C with shaking until OD600 value reached 0.6.
Protein expression was then induced with a final concentration of 0.5mM IPTG and the culture was incubated at +37°C for 4 hours. The culture was then transferred to a 1L sorvall centrifuge bottle and cells harvested by centrifuging at 5,000 x g for 10 minutes at +16°C. The supernatant was discarded and the pellet resuspended in Buffer A (50mM NaPi, 300mM NaCl, pH 8.0) to obtain a final volume of ~35mL. Samples were taken at different stages as shown below for SDS analysis. We can see our protein of interest produced after 2 hours and 4 hour incubation and in the lysate (figure 6).
3.2 Cell Lysis and Purification
The 35 ml sample with harvested cells was then lysed using Emulsiflex machine and was injected into the ÄKTA Machine for protein purification using His tag affinity method. During purification, flow-through and elution fractions (Figure 8) were collected on a well plate. Elution fractions were selected with the desired protein from the graph (Figure. 7), and ran elution fractions on SDS-PAGE. Fractions that contain the desired protein were pooled, frozen in liquid nitrogen and stored at -20°C.
3.3 SDS-Page of protein purification
After running the selected fractions on the gel, it could be seen that eluates (Figure 9) D1, D1, A2, B2, C2, D2, A3, B3, C3 and D3 had our desired protein. Hence these were collected for further protein concentration and buffer exchange step and rest eluates were discarded.
4. Concentration process and SDS PAGE
After pooling of the eluates it is important to concentrate the peptide samples. The protein was diluted in 20 ml of Buffer B (50 mM NaPi, 300 mM NaCl, 250 mM imidazole, pH 8,0). So the samples were concentrated using Sartorious VIVA SPIN 20 ultrafilter (Membrane: 5000 MWCO PES) and the buffer was exchanged to 10 mM NaPi pH 7.4.
For concentrating the peptide, first filter was washed with Milli-Q (~20mL). Then columns were filled with 20mL of the protein sample and Centrifuge at 3,000 x g for 30-45 minutes at +4°C (approximately half of the sample will go through the filter). The remaining sample were mixed by pipetting up and down and the centrifugation repeated. Meanwhile flow-through fractions are collected and run on SDS-PAGE to verify that the filter is not leaking before discarding them.
When ~5 mL of the old buffer is left above the filter, the column was filled up to 20 mL with our new NaPi buffer. Centrifuged at 3,000 x g for ~1 hour at +4°C. Repeated the step above (filling up the column with the new buffer) twice (or such that the amount of old buffer left in the sample is sufficiently low). In the end the desired sample volume in the column is ~5mL (figure 10). The protein samples are then collected and stored in liquid nitrogen at -20°C.
5. Ulp1 enzyme digestion and SDS PAGE
For digesting His6x-Smt3-DCD-1L with Ulp1 to obtain free DCD-1L, 0.5μL of Ulp1 protease was added to 50μL of the purified protein (concentrated in e.g. NaPi buffer). The suitable digestion time was determined by incubating the protein with Ulp1 for different time points and running them on SDS-PAGE. We can see that 10 mins of Incubation at RT is enough.
Undigested samples are highlighted with a white box: His6x-Smt3-DCD-1L 18.3kDa. The desired peptides after digestion are highlighted with a red box: DCD-1L 4.82kDa. The digested N-terminus containing the His6x-tag and the Smt3-tag (13.5kDa) is highlighted with black. Since the mass of DCD-1L peptide is very low, it was challenging to observe the corresponding bands on the SDS-PAGE gel. Instead, the band corresponding to the His6x-Smt3 part can be clearly observed from the gel.
6. MALDI-TOF Analysis
The sample after Ulp1 digestion was analysed using mass spectrometry to verify DCD-1L. We use matrix-assisted laser desorption/ionization-time of flight/time of flight (MALDI-TOF-TOF) mass spectrometer (UltrafleXtreamTM Bruker, Aalto department of biotechnology and chemical technology facilities, Espoo, Finland) equipped with a 200-Hz smart-beam 1 laser (337 nm, 4 ns pulse) to identify masses of proteins/peptides. Data collection was carried out by operating the instrument in positive ion mode controlled by the flex software packaged (FlexControl, FlexAnalysis). 5,000 laser shots were accumulated per each spectrum in MS modes. Protein Calibration Standard mixture I, II. The peak which is exactly half of our desired mass is due to the doubly-charged proteins/peptides. Since, the result is mass/charge ratio, when the charge is 2 we get half the mass as the result.
7. Antimicrobial activity assay
Bacterial cultures were grown until the OD reached 0.05 with corresponding 1.4*10^8 CFU/ml. The samples were incubated at 37°C, shaking for 40 mins with the respective antimicrobial peptides Nisin, DCD-1L and LL-37 (concentration used: 100 ug/ml). After incubation, the OD of the cells were measured. It was observed that the OD values in all the three samples with LL37, Nisin and produced DCD-1L dropped after 40 minutes indicating antimicrobial property of the peptides.
References
1)Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Mentjies, P., & Drummond, A. (2012). Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data.Bioinformatics, 28(12), 1647-1649.
2)Schittek, B., Hipfel, R., Sauer, B., Bauer, J., Kalbacher, H., Stevanovic, S., Schirle, M., Schroeder, K., Blin, N., Meier, F. and Rassner, G & Rassner, G. (2001). Dermcidin: a novel human antibiotic peptide secreted by sweat glands. Nature immunology, 2(12).
3)Schittek, B. (2012). The multiple facets of dermcidin in cell survival and host defense. Journal of innate immunity, 4(4), 349-360.
4)Malakhov, M. P., Mattern, M. R., Malakhova, O. A., Drinker, M., Weeks, S. D., & Butt, T. R. (2004). SUMO fusions and SUMO-specific protease for efficient expression and purification of proteins. Journal of structural and functional genomics, 5(1), 75-86. 5)Burian, M., & Schittek, B. (2015). The secrets of dermcidin action. International Journal of Medical Microbiology, 305(2), 283-286.
6) Nakano, T., Yoshino, T., Fujimura, T., Arai, S., Mukuno, A., Sato, N., & Katsuoka, K. (2015). Reduced expression of dermcidin, a peptide active against Propionibacterium acnes, in sweat of patients with acne vulgaris. Acta dermato-venereologica, 95(7), 783-786
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 127
Illegal BglII site found at 410 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]