Difference between revisions of "Part:BBa K2273113"
| Line 24: | Line 24: | ||
===Beta-Lactam Biosensor=== | ===Beta-Lactam Biosensor=== | ||
| − | In this | + | Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor Beta-lactam biosensor] in <i>Bacillus subtilis</i>. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.<br> |
| + | |||
| + | ===The role of the beta-lactamase PenP in resistance against beta-lactam antibiotics=== | ||
| + | |||
| + | In this project we examined the influence of the presence of PenP on our biosensor`s performance. Therefore we investigated the activity of the P<sub><i>penP</i></sub> promoter in the presence of different beta-lactam antibiotics and two controls (bacitracin and water) in a plate reader assay. The six beta-lactam antibiotics were: ampicillin, carbenicillin, cefoperazone, cefalexin, cefoxitin and penicillin G. The tested antibiotic concentrations can be taken from Table 1. | ||
| + | |||
| + | <html> | ||
| + | <figure style="width:49%;float:left;"> | ||
| + | <figcaption><b>Table 1: Antibiotic concentrations in [µg µl<sup>-1</sup>] (final concentration in the well) used in all further plate reader experiments. | ||
| + | </b></figcaption> | ||
| + | <img src="https://static.igem.org/mediawiki/2017/a/ac/T--TU_Dresden--P_Biosensor_Table4_finalconcentrations_correct.png"width="90%"> | ||
| + | </figure> | ||
| + | </html> | ||
| − | |||
| − | |||
<!-- --> | <!-- --> | ||
Revision as of 16:22, 31 October 2017
Short version of the Promoter PpenP found in B. subtilis
This Promoter is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)]. It controls the gene expression of the penP gene that codes for a beta-lactamase found in Bacillus subtilise. Yet there is not much known about the activity and activation of the beta-lactamase PenP in B. subtilis. The highest expression levels seem to be achieved when high salt concentrations occur. [http://www.subtiwiki.uni-goettingen.de/v3/gene/view/713BAB7190E1F86C55103049B29072F00E0DFFB3] PenP belongs to the class of Hydrolases and is able to break down beta-lactam antibiotics. The enzyme PenP harbours a signal peptide sequence and is most likely secreted and localized outside of the cell. [http://www.uniprot.org/uniprot/P39824] To investigate the influence that the presence of the beta-lactamase PenP in B.subtilis has on the sensitivity our biosensor, we analyzed the promoter activity of PpenP under antibiotic stress conditions. We amplified a short and a longer version of this promoter to potentially take into account all regulatory regions upstream of the penP gene.
This part features the RFC10 prefix and suffix:
| Prefix with | EcoRI, NotI, XbaI | GAATTCGCGGCCGCTTCTAGA |
| Suffix with | SpeI, NotI and PstI | ACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red)
Beta-Lactam Biosensor
Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous [http://2017.igem.org/Team:TU_Dresden/Project/Biosensor Beta-lactam biosensor] in Bacillus subtilis. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.
The role of the beta-lactamase PenP in resistance against beta-lactam antibiotics
In this project we examined the influence of the presence of PenP on our biosensor`s performance. Therefore we investigated the activity of the PpenP promoter in the presence of different beta-lactam antibiotics and two controls (bacitracin and water) in a plate reader assay. The six beta-lactam antibiotics were: ampicillin, carbenicillin, cefoperazone, cefalexin, cefoxitin and penicillin G. The tested antibiotic concentrations can be taken from Table 1.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]